Rattus_norvegicus Locus Mono:33:SNORA57
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:33:SNORA57
Rattus_norvegicus
Mono:33:SNORA57
X
SNORA57
1001..1141
2141
CTGATAAGTGGCTAATAGCCCAAATGCTTGAATTACCCTAGATGCCTAGAACAAATGAA
ACTCGAGACGGATGATCAAAATGTGAATGCTTCACTCCTTCTCTAAAAGGGGAACAAGAG
TACCCTTGGCAGGGAAGAGAGAGGCAAAGATTAAAACAGAGACTGAAGGAACTCCCATTC
AGAGCCTGCCCCACATGTGGCCCATACATATACAGCCACCCAATTAGACAAGATGGATGA
AGCAAAGAAGTGCAGACCGACAGGAGCCGGATGTAGATCTCTCCTGAGAGACACAGCCAG
AATACAGCAAATACAGAGGCGAATGCCAGCAGCAAACCACTAAACTGAGAATAGGACCCC
CGTTGAAGGAATCAGAGAAAGAACTGGGAGAGCTTGAAGGGTCTCGAGACCCCATATGTA
CAACAATGCCAAGCAACCAGAGCTTCCAGGGACTAAGCCACTACCTAAAGACTATGCATG
GACTGATCCTGGACTCTGACCTCATAGGTAGCAATGAATATCCTAGTAAGAGCACCAGTG
GAAGGGGAAGCCCTGGGTCCTGCTAAGACTGAAACCCCAGTGAACTAGACTGTTGGGGGG
AGGGCGGCAATGGGGGGATGGTTGGGAGGGGAACACCCTTAAGGAAGGGGAGGGGGGAGG
GGGATGTTTACCCGGAAACCAAAGAATTATTATTACGTATTAAATAAATTAAAAAAAAAA
GAAAGAAAGGACAATTTGTACAACTTCTTTGCAGAGACTTGTGGCGACACCTATAAGAGA
AACAGATGAAGCTCCGTCAGCACCTGCACTGTCAGGCCTGAAAGAGCCTGGGACACTTGT
GCAAGCATGGCTTCTGAAGTCAAGCATTGTGTGGTCTCCTCACTGTCATTTTGTTTCAGT
CTCCACATGTCACGGCTCTGCATTTCGCCTTATGCTATCGAATCAGTGGGAACCTGAACC
TCCAGGGTCAATAGTAAAACTAAGGCAACAAGAAAGTAGAGCAGTTGGCGGGGACCGGGT
ATGCAGGCCCGCTCCCCGTAATGTACGGAGGTAGAAGAAAGGGCTCCGGCCCTCTCGGTG
TTTTGTCTTCGGGGCTTGCGGCCTCCCGTGCGCAGGTTCTATCCTCAGACACCGGAACAC
CTCCGTGCAGAAATGCAGCTAAGTCCGGCAGTCCCCTCTAAATCACTCAACGCTTTTTAT
TTTCAGGTCTACATGACGCCCCCGGAGTGATAGTTAACGTTTTCTTTGCTGCTCATTGCT
GAACCAATAAAGTCTGTGAACCGTAAGGAAAAGAAAAAAAGAAAAAAAAAGAAAAAAGAA
AGAGCAGTTAGGAAAAGGGACCATGGCTCTTTCCCCTTCTCCAGCTTCTACAGGTAACCT
GTCCCAGAGTTTAACTCTGCCTCAATGCTTATATTTTTTAATTTTATGGTATGAACTATT
AATATAAATTTAAATATTATCATTATGAATTACTATATAATTCATGTGAATTGATATGAA
AGATTTCACAATAAAATTATAATAAATATATTTCATATAACATATGACATGATAAAATAT
ATAATTTACAAATAATTCATAGAATTATTATCTATCATATATTATATATGATATATAATC
AGATAATAATATATTATGAATTTCAACACCTGCTACCTCTTTCTCACAAACTCTATGTTA
ATGCTCTTTAACTTGGACCCACTGTGTCCCTCTGTGGAATCAGGAGACATATGTAATACA
TACATACATATGTACATAAGTACATTTGTACATACATATATGTATATATACATATATACA
CATGCTTTCACAGTGCTACAATTTTAATTATGTATATATGTGCATACATATATACATAAT
ATGCATATACACATATGCACATATAAACACATATACATATGTGCTTATACACATATATAT
ATACATTTGGTGGATAGAGCAGAGCCTCAACAGCCACACTTTATTTTTTCTCTCAGCCTT
TTCATAGCTTCTTAGACAAAAGTTCTTTATAAAATTACTTCACTGATAAAATATTATTTT
TAAAAAGGGAGTTATAGCAGGAAGTTGATAAGTTCAAACCAGTGTTTCAATGTATAAGCT
CCTTATAAGTTCAAAGCAATTTGCTTTATCATGGGATACATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved