Rattus_norvegicus Locus Mono:304:SNORA25
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:304:SNORA25
Rattus_norvegicus
Mono:304:SNORA25
2
SNORA25
1001..1136
2136
TCCAGACGGAAGGAGTAGTTCCTGTCTGGGATGCTGTAGTCGTGGTAGAAGGTGGAGGA
AGGACAGAATGACAGCACAGCGTTAAAGCTCCACCCCCAGCAGCACCGCCATTTTGGCCC
AAACAAATTCAAGCCCTACCTGCAATGAGGCGGGGAAATCCCGTCTCCTGGGGACAGAGC
CCTAAGGTTGGGGTTGAAACAGGTGAGATGTGACAACGCAATACACAGCACACGATGGAA
TCGAGAGGACCGCGTCTTCCATTAACAGCAGCCTAACCACATGGTTTAGTCATAGCAAGT
GCATTCAGTGCTTACAAGAACAGCAAAGACACCGTATGGCCTCACTCGAAATGTGGACAC
CGACGCCACTTCTAATTACTTCTTTTGTGATCGAAAATGTGGGCATTAGAAACTCTTTAG
GAATTGAAGGAATCCAACAGGGAGGGCTGGAGGAAATGCTTACCAGGCCGTGGAGGTGCT
CACCACCTGAGTTTGATTCGTCAGTACCCACAGAAAAGCTGGGTGTGGGGGGATGTGCTT
GCAGCCCTAGCACCAGAAGTGCGGAGGCAGGACGATTCGCTAGCCAGCCAGCCTAGCCAA
GCCAAAGATAGTTCACAGAGAGATATTGTCTCAAAAGGGAAGGCAGACATTGACAAGGGG
AGAGATTTAACACTGATCTCAAGCCTTCACGCACACCCCTGTGGTGGTTTGTATATGCTC
AGTATACAATAATAGTCCCAGTCTAGGGAGTGGGACTATTAGGAGGTGTGACCTTCTTGG
AGTAGGTGTGGCCTTGTTGGAATAGGTGTGTCACTCTGAATGTGGGCTTTAATACCCTAG
TCCTAGCTGCCTGGAAGTGAGTCTTCCACCAGCAGCTTTTAGATGAAGATGTAGAACTCT
CAGCTCCTCCTGCACCATGCCTGCCTGGATGATAATGGACTGAACCTCTGAACCTGTAAG
CCAGTCCCAATTAAATGTTGTCCTTATAAGAGTTGTCTTGAAGGTCATTTCAAAGAGGGC
TTGATGGCTGTAAAACCAAAAGCTCTTAACTCTGTGACCAAAGATTGACTTGATGTTCTT
CATAGAGCAGATCATGCACTTTTTGATAGTGCTGTGTTTTTTTCTGAGTTGCCTTGGTCA
TGGTATCTGTTCACAGAAGGAAAACCCTGAACCTCTGGACCTGTAAACCAGCCCCAATTA
AATGTCCTTATAGGAGTTGCCTTGGTCATGGTGCCTGTTCACAGAAGTAAAACCCTAACT
GAGAACCCACCTCCCCCATACCAGTGGTTCTCCACCTTCAGTCACAACCCCTGTGGGATC
ATAGATCAGATATTCTGCATATCATACATTTATATTACTATTAATAATAGCAGCAAAATT
ACGGGTATAAAAGTAGTGAAATAATTTTATGGTTGGGGTCATCACAACATAAGGAACTGC
ATTAAAGGGTAGCAGCATTAGGAAGGCTGAGAACCACTGGTCTACACACACATGAGCATG
GGTACACACATGCATCACAAACATACAACAAACACATGAGCCTCAAGTGGCAATGGCAGG
ATCCTGAAAGCAGGGAAATCATCCCCATATTGTCCCTCAGAGGAGTGTTACAGAAAGTGG
GATCCAGTTGTAGAATGACCTAAAGTGTAGGTGCAATGTGTATGTTTCTGGGCTCGTCCC
TAGATACACTGGATTGTATAGTGGCAAGATCTCCAGCTAACTGGCAGTCTAGGTCATCCC
CCATCACAGCCCATCTGTCTCCCCAGCCCCTTAGGGTTTTACTACATAGGTGAGTCTGTT
CTCAGGCTCAGAATCCCTCTGCTTCAGCCTTCCAAATGCTAGGATGACAAGTGTGACTCT
GACACAGACCGGCTGTGGAGATTTGCTCCTCTGGAAGCTGCAGGCTTCAGCGGAGTCCAC
TCCTGCCAGCGTTCGCCCTACTGAGCACTCATGTCTTCCCATTGGTTTTTGCTCTGATTG
TCTAGGGTTCCACAAGCAGTGCCAGCAGGTATGAACAGCCAGCACAAATGCTCTCGGTTC
TGTGCCATGAATCCTGCTGGGCTTTGGGGTTTCCTGGCAGGCATAGGAGTGGGGGAACTT
TCTACAGAATAGTTTCTAATGAGGGGCTGTGTCCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved