Rattus_norvegicus Locus Mono:553:SNORA15
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:553:SNORA15
Rattus_norvegicus
Mono:553:SNORA15
10
SNORA15
1001..1127
2127
CAAAGGCTCAGCTCTGGGACTTCTGCTCTGCCTTCTAGAAGAGCATGCTAGCTCCATCC
TCAAAGCTGCTTTCTAGACCTGAGCTTCTCATGCAGGTGACAGATGCCCTCTCTCCCAAA
GCCTTCAGCAAAACCAACTTACTGACCTCAGGCTCATTCTGTATCCGGCACCATGACTCA
CCTTGTATAGCTTGGGCTGGGGCGGCCAGAAGTCATCAGGCACATGCTTTTTTATCTCAG
AGGGTTCCCCGCCCAGCACATCCCAGAACTCCGGTGGCTCCTGACCCTGCACCAGGAGCG
TGATTTCCGCCTTCCCTTTCCGCTCATTCTTGTTCATTTTCTCTGCAAAGAGTCTAGGGA
CAGACGCAAGCTCTCAGCAAGGCCATGCTGTTCTTAGGGGAAGCCTTCCTTTGCCCAGAA
CATTCCACAAGATCTACCTACCTGGCCTTTGTGGTGTTGCTCAGTGTGGCCTGGGCCCCT
CTCCATACATAAATGTCCAGTCCTTGGTCCAGGAGAAACACAAACCTGGACAGGACAGGA
AGAGCTGTAATGTAATGTAACCAGATGGGCTCTGGTCCCCTTTTTGGGCAGACCTCAGGC
TTTTCTGCCAAGTTCTGAGAAGTTAACAAGGTTGCTTCTTCATTGTGGGGAGGCAACTGA
GGTCAAGCACCCCTGCTTCCTATGGTACGGGAGCTCACCTCGGATCCAGTGAGGTCCCCT
TGAGGGGCACAGGCTCCAATTTGATGTTCTTTTTCCCATACACACGGTACATCCTGGGGA
GCAGAGCAAGAATGACTCATAGTAGGCATGGCTGAATACTGTGGTTTTTTTTTTTTAAGA
TTTATTTATGTATATGAGTACACTATCACTGTCTTCAGACACCAGAAGAGACAATCAGAC
CCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTG
GAAGAGCAGTCAGTGCTCTTAACCATTGAGCCATCTCTCCAGCCTGAATACTGTGTTTTT
TAGTCAGTAATTTACACAGCCAGACACCATGCAAAAGTAAAGGCTTCCTTTAAGATGGCT
GATCACGCTATATTTTATGGTATATCATTATTAAAAGTGAATATAAAGTAAAAAAAAAAA
AAGACTCATTGTGAGCACCCAGGTCACCTGACCTAACACCCTTGCCCAATCCCAGCAGTC
CAAGCCAATCGCACCCATCGCTGCTGCGTGCTTACCTGGTAACATAGTGTGTGTCTTCCA
CAGTATAGAAGCCACTGGCTGTTCCGCCTTCAATGTAGGAGATGTCATTGTCAAACACCT
ATGTGTGTGAGGATGGTTCATGACGGAGTTGTTCTCTGCCCCCACCAAGTACCTGCTAGG
CTTGGTGGAGTTTACACAACTGAAGTGTGTGTACAAACCTACAGTCGTTCTAAACAGCAT
GAGGTGTATACTGGAGCACAGGGCTGCACAAAACTGTCCCAAATGGAGGACAGTCTGAGG
GTGAAGCTTGCAAACCCGGGAGGGCCTGGACTCAACTCTCTAGCTCCAGGCTACGTCTCT
AAAGGGAACCCAGCTGGTAGTAGGGGTAAGTCAGTTGGCCAACTGGCTTTGTGGTTTATT
TTTAGGTTTGGTTCTGCTCTAACCTGTAATCTATCCTGGCAGCCATTGGTCCCAGCCTAT
CTCTCAGCCACATTCCTTAACTTGTCTATCAGCTTCCAAAACAATCTGCACTCCCTCCCC
GTCAGCCAGTTTCAGGATCTGAGCACCTTAGGGTCCCAGACCTCACCGTGCTGTGTGTGC
CTCTGGCCTTAGCCCCCCTGCCCCACCTCTGCATGTGGCCCAAGCTGCCCCTGCCGGAAG
CCGCACCTGCAGGAAGCCCTCACTCTCATCGCCCATCTCCTCCCGCGCAGTACGGCACTC
AGCGCCCAGATAGTTGCGCAGGTTGACAGCATGAATGGCAGAACAGGCTTTCTTGTCAAG
TGTGGCCTCCCCGCCAATCCAGTAGTAGATCTCCCAGTTCAGGGAGCCGCTGTCATCCAG
GAAGGTCTGAGGAGATCAAGTAATCAGCCATGAGGGCCTTCCAGGGCTTTCCAGGCCACA
TGCATGGCCACTGCTGCCTCAGCTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved