Rattus_norvegicus Locus Mono:6:SNORA62
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:6:SNORA62
Rattus_norvegicus
Mono:6:SNORA62
X
SNORA62
1001..1153
2153
AATCTAAATTTTAGCTCAGAACTTAGTGAACCTCAGCTTCTTTTATTGTCATTATATTT
AAGAACAGTAAATTTATCTTCCACCTTCCAAAACTGAACAGACTAAAATCAACGCCAGGC
CGTGCAGTTGGCATTGGAATCCGAATCAGAATGGAAGGCTCTTGTTAGAGATAACATGAT
ACATTTGCTTCAGCACTACACCAACTGTCAGATCTCCACAAAGTGTTATGAGAACCTGTC
CCCAAATTTTACTTAAAGCCTACTTTAAAAACATTAGTATTGAGGTTAGACTGACTGCAT
CAATGAGATCAATTTTCACAGCATCCCATTCATGCCTTTTGCCAAGTGACTGCAATTCCT
CCCATGAAGCGATACAAATATTCTATTCGTGTCTGAGTTCGGGTACACTCTTCAGGTACA
ATACTGAAATATTTACAAAGATTACATAACTGAGGGCTTGAAAAATATTTCTTGTATCCC
TGTCAGTGCCATGAAAACATATCTGGGCTGACCTGCAGAAGGCACGTCACTAAGATTTTA
TGGTTGCTATGGCATTAAAGCAGCGGTTGATACAATTCTGTATATTCTCCATGGGGAAGG
AATATACTTACCAGAGAAGACGAAAAATAAAGTCTGAATTTGAAGTGAGTTGAGACTTCT
GCACTAAATGTATCAAGAATATGCTGATCTGCAAAAGAAATTAAAGAAGGAAAAAGGAAT
CCCCTAGTGTAAAAGTCTACAATAGACAAGAAGCTTGGTGTCGCAATTTCACAAACAATT
TCAGGAACGTAGGCTCCTTCCATCCTGTTGCTCTACTACGGTTACTCTGTCGTGAAAATT
ATTGTCATCACATCCGTAATCAAACCAGGGCAGAGAGAAGAGGAATAAAGGGATATGGAT
TTTCCTTCCTTTAAAATAGCTTCTGGGAGACAGTTGTGGTAATAAACGCCTACAATTGAG
ACACTCCAGGCTGAGGCAGAAGGAGCATGCTTTTGAGGCTGGCTGGATTCTATTCTCCTC
ATTAGAATGCATCCATATCCAGTGAACTTCTGAGTGTCGGAAGTGTGCTACGTTGAACCT
ATGGCAGGATTTTCGCTAACACCAGTAGAGCTGGCCTCTATGACTGGAGTTTAGTAGTGG
TCACTGCCACATATGTTAAAAAAATGCATTCATATGTCAAATTCAATGATAACAAAAACT
AGAAATGTAATCTGTATTCTGAGCATCCATGTTCTCAGAACAACAGGTTTTATAAACTTG
AAAAGGAGAACGGGGACATACAAGTGTAACTAGCTGTCTTCACCTCACAATCACAATGGC
TGAATAAGTAGGATTAGTAAATCATTAAACTGTGGGTTTTCCTCTCAGAGCATAGATACG
GTTGCCAAGATACTGGATCTGATACAGGAAGGACCCAAGGATGGCCTTAGTCATTTCAAA
CTCACTCTGGATACATGAGATTCTGCAACAGTAGTTTGAGGGCTATTAGCTTATGGTGAA
AAAGTAAACTGACCTATTTGACTTAACCAAAACTTTCCAGTTACTTTTTCATTTGATTTT
CTTCAGTCAATCTCTGGGCCCCCTGATTGACTTTAGAATTCTTGCCACTTTTTAATTTTT
ATTTTTACAAGGGTCAAAATCAAATTGGTTATAGTTTTTATTGCTCTCAATTTTAGCACT
AAAGTCATTTTAAACAGCTGCATGTGGAGGTTACCCTGTACTCTACTTTTTCCAGCTTTC
TCAGAAGCCTTTTTAAAAAAGGACTGATTTTTATTTGATGTGTATGGGTGTTTTGTCTGC
ATATATGTCTATATACCACCTGCATGCCTAGTGTCCATGGAGTTGAGAAGGGTGTGTTGG
GTATCCTGGGACTATACTTAACAGAAGATTTGTAAGCTGACATGTGAATACTGGGAATCG
AACCCAGGTCCTCTCAAAGAGCAGCCAGGGCTTTTAACCACTGAGACATCTCTCTAATGG
TTAGATGCCCCCTACCTTTAAAAAAAACTGAGCCAAAGAAAGTCTCAGGGACTTCTGAGA
TTCCTAGATAGTTAAAATTTGTGCTGACCCTGCTGTAGGCTCGCCTCTTTAATCTTCCAC
AGACACTTCTGCCTTCTTAAATTTGCTCTTCAGTTCTGGTCTCCTTTGTAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved