Rattus_norvegicus Locus Mono:377:SNORA72
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:377:SNORA72
Rattus_norvegicus
Mono:377:SNORA72
19
SNORA72
1001..1109
2109
AGCTGAACCACATAGCACTCTGCAGACTTGGAGACATTTCTATCTCCCCTGGAGATCAG
GAACAGCTTTGGACCACCTCTGTGGCTTCTACTCTCTCCTGCTAAGGCTCAGTCCCCTTG
CTGGGTCACACTGCCCACTGCAGTCTGGAGGGGCTGCCGGGAGCAGTGTTGGAAACTTCA
GGGATCAAGGGGTGTGGTGCCGCCCACAATTGACATGTTCGAGGCAAGGATCCTGGCTAT
GCCGCCTTGCCAGCACCCTCCATTGCAATATCTCACACATCCTGCAGAGTGTGTGTACAG
ATGGAGGCTGGTTTCTAGCTCTGTGTCAGGGACCTGGCAGGCAGGCAGGCAAGTCTGGTT
TTATGTGTTTCTCTACAGCGACCATACACAGGGCTTTGCAAAAGGAGAGGAGACTGCAGT
ATGTGTGCTGGGCACATCGAGTACAGCCCAAGGCATCCTTTCCACTCCGCTGGCAACATG
GAGGGAAGCAGGCAGGTCCTGCACAGCCACCTCTGCACCAAGTGCTGAAGGTTGATGTCT
GGTTCATTGCAGACTCCAGGGCACCACAGAAGCAGCAAACGGCTCCCTCCATTCAGTCTT
CCAGGGGAGGCTGGAAAACGCCGTATTCTATATTGGGACTTGTTGTGGGGCCAAGTGAGT
CTGCTCAGGGTTCTGTGCGTCGTGCTGCATGGCAGTACTGGGGTGTAGAGTTATGTGCTT
TTAAGGAGGGGTTCAGCCACATGGTGGTGGCACCTGCCTTTAATCTCAGCATTCAAGAGA
CAGAGGTAGGTGGATCTCTTAGTTTGAGGCCAGCCTGGTCTACAGAGCGAGTTCCAGGGC
AGTCTGGGTTGTACAGAGAAACCCTGTCTTAAGAAGAAGAGGAGCTGGGGTTGGGGATTT
AGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCC
GAAAAAAAGAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGAGGAGGAGGAGGAGCC
AGGCTAGACATTCACTATAGTAAGACCATGCATGTGTCACCAGAACTAGTTCTTTACCTG
GGTCTGGTTTTCTGAATGCTGGTGACCAGCCAAAGGAAGAGGAGGAGGAAGAGGAGGAGG
AGGAGGAGGGAGGAGGAGGGGAGAAGGGGGAAGGGGGAGGATGAAGGGAGGACAAGAAAG
AAGTGGGGAGGATGAGGGGAGAAGGAGGATGAGGGGAGGAGGGTTAGGGGAGGAGGATGA
AGGGAGAACAAGGAAGAGGAGGAAGGTAAAGAGAGGAGGGTAAGGGGAGAAGGATGAAGT
AAGGACAAGGAAGGGGAGGAGAGGAGGAGGAGAGGAGGGTGAGGGGAGGAGGGTGAGAGG
AAGAGGGTGAGGGGGGACAAGGAGGAAGGGGAGGATGATGAGGGGAGGAGGGTTAGGGGA
GGATGATGAGGGAAGGAGGGTGAGGGGAGGAGGGTGAGGGAAGGAGGGTGAGGGGAGGAT
GATGAGGGGAGGAGGGTGAGGAGAGGATGGTGAGGGAAGGAAGGTGAGGGGAGGAGGGTG
AGGGGAGGAAGATGAGGGGAGGAAGATGAGGGGAGGAGGGTGAGGGGAAGAGGATGAGGG
GAGGAAGATGAGGGGAGGTGGGTGAGGGGAGAAGATGAGGGGAGGAGGGTGAGGGGAGGA
GGTGAGGAGAGGAGGGTGAGGGGAAGAGGATGAGGGGAGGATGATGAGGGGAGGATGGTG
AGGGATAATGAGGAGAGGTGGGTGAGGGGAGGATGATGAGGGGAGGAGGATGACAGGAGG
AAGGGAGGGGAGGGAGGAGGGAGGAGAGAGCTGTTTTGTTGATCTGGAGCCACTGGCTAA
GCACTTTCTCCAGCAGCTGTTCAAATACTCTAAAATGTTATCTTTGCCACTTGCTAGTTT
AAAAAAAAATCAGCATTATCCAGGCATAATCAGTGTGCCAAGCCCTGCCTGCATTTAGTG
TGTGCAGTTCAGTGAGTGTGGTGTGGTTGTGGGTCTGGATACCCTGGGGTCTCAGACACA
TCGTTCATGAATCTCCTCACACTCCCACCTGAGGCTGTGGTGAAGTGTGGCCTGCGGTCT
GCATGCCTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved