Rattus_norvegicus Locus Mono:445:SNORA24
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:445:SNORA24
Rattus_norvegicus
Mono:445:SNORA24
15
SNORA24
1001..1115
2115
ATGCGAAAAATCTTATGCTTTCTTTGAGCTGAAATCACTTTGCTGATTATTTCCATTTG
TTGTCTTTTGAGAAGTGGTTTTCAACTGTTGGCGGAATGATAGTTTTTGGTTAAAACGTT
CTTTGTAATAGCTAGAAAACATACATGTTATAGTTATGACAGGAATAGATTTTTTTCCTT
AAAAGATAGTTTGAGGGTAAGTAAATCTTTGACATTTTAAAAGTTTGAAAATTAACCTTT
CGGATTATTATGCTATTTAAAATAAGGTTCTAATATGAGCTTTTAGTTACCAAGAGGGAC
TAATAACATTACTTTCTTAACCAAAGGAGTATGGTAGGAATAAAAAGTTAATCTTGTGAA
AGTGGTTTTTGAACTTGGAGCCATTGATATAGTTAATGTGGTCCACTAGGAATACTTGTT
TTAACCCTTCATTTTTGGCAGAAAGGGAAGGCCCTTGTTTTCCTGGCCCGGAAGCATATT
TTCTCATTTTTGGCAACTGAGTTTTAAGACATTTTCTATAATTCCATTTGGTGTATCTTT
GGAACCTGGTTGCTGTGGTGGCTTCCTTTTCTTTCTTTCTTTCTTTTTTTTTCTTTTTTT
CTTTCTTTTTCTTTATTAACTTGAGTATTTCTTATTTACATTTCGAATGTTATTCCTCTT
CCTGGTTTCCAGNNNNNACATCCTCCTAANNNCCTCNTCCTCNNNNNNCTATATANNNNN
NCCCNTNNNCCATCCTCCCCCCATTAACACCCTTNCCCCCAACAATCACGTTCACTCGGG
GTTCTGTCTTGGTAGGACCAAGGGCTTCCCCTTCCACTGGTGCTCTTACTAGGCTATTCA
TTGCTACCTATGCAGTTGAAGCCCAGGGTGAGTCCATGTATAGTCTTTGGGTAGTGGCTT
AGTCCCTGGAAGCTCTGGTTGGTTGGCATTGTTGTTTATATGGGGTCTCGAGCCCCTTCA
AGCTCTTCCAGTCATGTCTCTAATTAATTCAACGGGGGTCTCATTCTCAGTTCAATGGTT
TGTTCCTTTTCTAACCACAAAAGAGCAGATTCTTGTTTATTGTCAAAGCTGTCACTATTT
AATTGGTATCAGATTATAACTTGCACAGTAACCTTCTTCACCGTGAGGAGATTCTGGGAT
GCTAGGTTCTTGGATGTGCTTCTCTAAACTAAGGAACATTTTCAGTACCTAATGTACACT
GTACACCGCATGTAGAATAGTGTACAGGGTTCATAGCGAACCTATGGCTGCCTGTGTATA
TAGTATAATCTATAGCTGACTACTTTACAGTGTCTGCTTTCTCTCATTGGAATGAAATTT
ACAGCAGCATCTGTATTTTGTATTTTATGCCATTGTTCATTGTTTTGCCTTTTTTTCTCC
TCACCTAAAAATCCAATTTTATATATATATGTATATATATATATATGTATATATATATAT
ACATATATATATATATATATATCTTTTTCTCCTTTCCTGGGAAATTTCTAAGATCACTTT
TAATATTTAAATTTCTCATTCAAGGTGTTTCCGGGGGGTTTTTCTTCATTTTGATCTAAG
TCTTATTTCAATAACTTAATTTTATTACTATCCTAGGTATGCTTTACTGACTTAAAAGTC
TTACGATATTTCTAAAAAAAGTAGCGTAAGTCAGAAAAATATTGTCAGACATGCTAGTTC
ATACATTAATCCAAGCACTCATGAATTTCTGGCCAGCCTGGCCTATAGAGACTCTTGCAA
TACCAAACTGAAAAACAGTAGTGCACACCTTATAGAAAGCCAAAATAGTTTTACTTTTTC
TCATATATATTTGTGTTTGCTTTTACAGCTAAATTGTGGTAATCTTAAACGCTTTTGAAC
CTTTGAAAGTACCTCATGTATGTACAGTACATTTACTTATATGTATTCATGTGAGAATAT
TTTTAGCTGCAAGTAAGAAAAATTAGTTACACAGTAAATTAAGTTGATATCTCAGATAAC
AAGATGTCTGCTAGCTCATGCTCTATTTGCCCAAGGTGAGATACCAGCAAGGGGTAGGAT
GCCTCTGTACATGCGAGAATAATCGATACACGGTATAGTTTCATTTAAGTGTTCCTTCAT
CAATAGGTTTGTTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved