Rattus_norvegicus Locus Mono:305:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:305:SNORA44
Rattus_norvegicus
Mono:305:SNORA44
2
SNORA44
1001..1105
2105
ATTCTATGAACCAGTCCAGACTCCTCTTAACTTCAGCCTCTCAATAGCTTCTGGTCACT
CTTTGATGAAGTAGCTTTCTTCCTCCATAAAGGATCAGTACTACGTAACCCTTCTCAGTA
GGCTCTGTGCTGACTCTCGAGACTATTTGAAATGTATGGATTTGGTCTCTGGACTCCATC
CTTAAAAACAAATCTTCATGCATTCCTGATGTTCATTCATGTTTATAAGTGAGTGCATAA
ACACTATCATTGTCTCTTCCCATTCTCTAAATTAAAATTTCAGTGTTGCCTGTCTTATGA
AATGACTGTCAAGATAGGCAGTCAATGACCACATCAGTTTCAATAAATTTGTTTTAAGCT
GATAAGTGCTCTCTTTCTTCATGTGCTAACATCCTGGGCAGATTAAGAGGGAGAAACCTG
GTTATCTCTAGATGAACGTCTAACAGTGGGATTCTAGACACTCAGCAAAATACATGCCAA
GATACAAAACCTGAAAACTTTCAGGGATGATGGGAAAATATCTGAGGCCGAAAATATATT
AGCATCATATAAATATAACCACCAATATTATAAGCTCTAGTCTTTACCACGAAGCCTGCT
TAGCTTAGTACTGACAGACTCAGGACAACAGAAAGGAGGAAGAACCATGGGATGTTTCCC
TGTTAATTGCAAATCGAAGGTGAAGAGTTGCTGTCTGTTTCTTCAAGTTGTCATTGTGAC
CATAGCTTGTCTTCCTATGCAAACAGAGAAAAAATGGCTCTGAATAGCAGATGCCATTAA
GTCCAGAGATAATAGATTTTGTGGATAGATGACAATGATCCCAGCCCCTCTTCGATGAAC
CTCAGAAACTCTGCCAATCTGGCAGCATATAGTAAATGTCATAAGCCAACATGTGACCGT
ACATTCCTCTGCTAAAGGCATATTACAGACACAATGCCAAGTCAGAGAAAGCATGATACA
TGGTACAGAGAGGTCTATTTCTATGAGTCTAAACATGGAGAAAGAAAGTTTCTTTGGATC
TCCAACTGCATGCCAGAGTAATGGAGAGACTTTGACAGCCCAGGTCATCACAGTGCCTGC
AGTTGCCACTCAGTTCTCCTATATGTTAAAAGAAATAAAAAAGGAAGTTTCTTTGTCCCT
AAAGGATACTTAACTGGCTTCAACCCATCATCCTCCATATATATGTGTGTGTGTGTGAGT
GTGTGTGTGAGTGTAGGAAAAGAATCTTCATTTTTCAAACAATATGATTTTTGTCACATT
CAGACGCCAGGTTCAGAGAAGCTGCAGCCATCTTGCAAGCATGATGCCAAACAGCTACTG
AAGGATAAAAGCAGCTATACCATAGATGGCACCGGAGAAAGATGGAGAGGATATTAGTGC
CTGGAATTGTCTTTGAGTTTCTAAATTATCAAAAGGAAATACTAACCTTCCACTCGATTA
GGTTAAAAATGTTTATATAATTTTAAACATAGTAATGTTTTATATAAATGAGAATTATAA
AGTCTTCCCATGGCATAATAAATATCATGTTTGCATACAGTTCATGAATGATACCAAACA
AAATGTTGAGTTTGGTGAAGGAACTATCATATGGACAGTAAAAAATCAAGCCTCCAGAGA
AGACAGGAGTCATTAGAGCTTAGATCTTCCACAGAGGACTGTCCAGGTCAGAGGGTCCAG
TCTAACACTTTACCTGGATGGAAGCATTATCATTGCAACATAAGACATGCAGCATGTTCC
CTCGATGCACTGTTCCCAGGGGGTACAGCACAGCCTCCACCTAAGGAGGACCCACGTTTC
ATTCCTGTATCACAGAGGACCACTGACCAAAAATTCAAGCTCACGGTGTTGATGGAGAAC
GAAAGGTGAGAGATAAGCGATCTTCTGGCCTTAAGCTTTTTCACTTATGGAAGACCCAGA
GTCTTACCTTAAGGGTAGGGAAGGCCCTGAAGGTAGCCTAGCAAGGAAGTGATACGCTCA
GAACTGCTCACTGCCATATCACCATAGTGGCAAGGGATAGGCCTGGAAGGCAATACCATG
CACACCTAGGAGAGAATCAGGGTTAGTGTTAGTTTACCACTCCAAGAGAGACATGCAATT
TAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved