Rattus_norvegicus Locus Poly:0:SNORD113
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:0:SNORD113
Rattus_norvegicus
Poly:0:SNORD113
6
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1081, 2751..2831, 3636..3725, 4535..4615, 5417..5502, 6307..6400, 7203..7287, 8092..8177, 8982..9067, 9871..9965, 10768..10853, 11658..11752, 12553..12647, 13450..13534, 14341..14431, 15232..15323, 16128..16214, 17019..17113, 17918..17998, 19704..19788, 20592..20685, 21489..21569, 23262..23355, 24162..24242, 25048..25133, 25936..26022, 27036..27116, 27922..28009, 28812..28901, 29707..29787, 30594..30684, 31487..31573, 32380..32460, 34343..34430, 35233..35317, 36128..36208, 37014..37102, 37906..37992, 38799..38879, 42320..42408, 43210..43299, 44107..44187, 44992..45081, 46897..46983, 47791..47871, 48678..48766, 49569..49657, 50776..50868, 51673..51761, 52569..52649, 53455..53541, 54347..54434, 55241..55321, 56125..56209, 57020..57100, 57906..57993, 58795..58882, 59689..59769, 60575..60662, 62034..62121, 62924..63009, 63817..63897, 64703..64791, 65594..65680, 66489..66569, 67376..67468, 69231..69311, 70117..70210, 71016..71104, 71912..71992, 73775..73855, 74662..74746, 75556..75636, 76445..76531, 77332..77424, 78230..78310, 79116..79206, 80014..80094, 80901..80990, 81797..81880, 82687..82767, 83574..83654
84654
TTCTATGAGTCAAAATTATCCTAGTGGTACTTGTTATCTGTTGCCCAGTAAGCCTGCCT
ATCTTAGAAGACAAGAAGAGGGTTGATGTTGGATCAATGATGACTGTGGGTGCTGTATGA
GTCATGTATGAGTCATGATCATGACAACAAGTCTGCGAGTCTGAGGTTCACATCATAATA
TATGTAGTGCTTAGTATGATCTTAGTAACTGATGTTTGCAATAGTCTATTTTACACCTAG
ATAAAATATACATCAGAATAAGGTGGAGAGTCAATGAGAGAGGCAGACATAATGTATCAA
TAAGTAAACATATTTGTTAATCCTTTTATAATTTATCTGCTTTTTACTCTAAGAATGGAT
ACCTCCAAAGTGATTTACATGTTCTTCCTCAGTCTTGAGAATTGGGATTCCAAGTATGGG
TCTGCAGAATTGAGAAAGTGTGAGTTTAACCTATGATCTTCTTTAGGATTTATTTGGCAT
TTAATCACAGTTACCAGACCATGTTATTATATTAGAACAGTGGGTATAGCCAAAGGTTTA
ATATGGCATGGATATGATATACAATGTTCAATAAAATAATAAAAAATTAACCATGTGCTA
AGACGGAGATAGTCATCATTGCAAAAGATCCTGTAGAGGTTTAAAGTACACTCAAGTATG
GGTCTGCAGAGTTGAGAGAGTGTGAGTTCATCCTATATTGTTCAGTACGATTTTTCTTTC
TTGCACATAATGCTTCTTCCCGTCTGAGTTGATTATTTTGGGACAGTAAATGTAGAGAAT
GGTTCAATAAGGCATGCATACGAAAAAAATATGTTCCATGAAATGATTCCAGAAGAAGAG
TGATGAATGACAGAGTTAGAGACCACTGACAACGATGCTGTAAAGTTTAAAGTACACTCA
AAGATCTGGTAGTTAATGTTGGTTTTCAGTGGAAATCTTACCAGCACTACTAGTGATCAG
CTGCTCAATAAATGCAGCACAGTTGACTGGGGGGATGATGTTGGATCATTGATGACCATA
AAAGATGTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGCGAGTCTGAGGTCC
ACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAATAGTCTAC
TTTGAAAACAGTGAGTAAATGTAGATTAAAGAAAAATTTGGAAATCGTGTCTATTAAAAC
ATAGTCATATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGAT
GACAGAGGAATCCCCATCAGCCATGGAAAATCATTGTCTATGTTCCTGGTGACGTCACAG
TCATGGCGGTTTGATGTGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGG
GATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAGTGAAGAGA
AAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGG
TGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCTGGTTTGGGTCTGCAGAAT
TGAGACAGTGTGAGTTTTTCCTATATTCTTGGGTCGGATTTTCTTTCAGTTTTGCGTTTC
ATGCCTCTTGCCGTCTCAGTTTCTTATCTTGCAAGAGGAACTGTATTCAAAGGATTAATA
CTGCATGTGTAGAAATGAAAGGTTCCATAAGATAATTCCAAATTGAGAGTGTACAGGGAA
AGAGATGGCGATGACTGCAAAGGGTTCTGTAAAGTTTCAGGTACACTCAAGGATCTGGTA
GTTAGGGATTCCTTTTCCTTTTTCTTTCCTGGATAATCTATAAACAATACTAGTTAAGAG
TTTTTATTCAATGACTAAATTTAGAGACTGGAGGGATGATGTGGGTTCAATGATGACTAA
ATCTGCGAGTGTTGTATGAGTCATGCATGGATGATGAATACAGCTTTCCAAGTCTGAGGT
CCACATCATAGGATGTAGTCCATCTGGGGATCTTGGTAACAGATGTTAGGGATAGTCTAC
TTTTCCCCATAAAGAAATGACAGTTAAAAGACAAATCTAGAAAGCATATCCAATATGATG
CTAAATAGTATTTCATTCAGATAGGATGACAGAGGATTCCCCATGACTGAGCTAAAATCG
TTGGCAATGTTCTTGCTGACCTCAGAGCCGGGAACGTTTGATGTGCCATGAAGAGCCTAC
CATAGGATGTCGAAGGTTCCAGGGAGGGATTAGGTGGAGGATGAACAGGAGAGTCAGCTA
GAAAGTCCGGGTGAGGGAAGAGAAAATTAAGCGTTTCATAATTTTTCTGCCCTTTACTCT
CAGAATGCATACCTCCAAGGTGACTTACACCTTCTTCCTCAGACTTGAGGTTTGGGATTC
CCGGTTTGGGTCAGCAGAATTGCGAGAGTGTGAGTTCATCCTATTTTCTCAAGAACAATT
TTTTTTCTTGCATGTATTCCCTCTTCCTGTATGAATTTAGTATCTTGGGAGAGCAACTGG
AGACAGTGGTTAATTAAGGAACACATACGAAAAATATATGTTCCATGAACCGATTCCTAT
GAAGACTGTGCAATGACAGAGGGAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTC
CACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAATCTAACCAGCACTACTAGG
GATCAGCTGCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGGGATGATGTTGGATCATT
GATGACCATAAAAGATGTGGGAGTCGTCTGAAACATACATGATGACCACAACATTGCGAG
TCTGAGGTCCACATCATAATCTATGCATTGCATGCTGGGATCCTGGTGAGAGATGTTAGG
AACAGTCTACTTTGAACATGGAGTTTTAATGTAGATTAGAGAAAAAATTTAAATTGTGTC
TACTAAGACATAATCCCATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGCC
AGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGGTG
ACGTCAGAGTCATGGGTTTTGATGTGTTAGGAAGAGCCATCCAATTGGATTGATAGCTCA
ATCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGCAAATTATGGAGAGTA
AAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATACCT
CCAAGGTGATCTCCAAATTCTTCCTCAGTCTTGAGGTTTGGGATTCCCAGTGTGTGTCAG
CAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGT
ATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAAT
AAGGAACGCACACGAAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGTGTGCAATG
ACAGAGGTAGTGACCACAGCCAAAGATGCTCTAGAGTTTAATGTCCACTCAAGAATCTGG
TAGTTAATGTTAGTTTTCAATGGAAATCTAACCAGCACTGCTAGTGATCAGCGGCTCAAT
AAATGCAGCACAATTTAGAGCCTGGGGGGATGATGTTGGATCATTGATGACAAAAAAAAA
AAAAAAGCATCTGGGAGTCCTCTGAGACATCCATGATGACCAGAACATTGGGAGCCTGAG
GTCCACATCATAATCTATGCATTTTATGCTTGGATCCTGGTGAGAGATGTTAGAAATAGA
CTAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGAACCATGTCT
ACTGAAACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGCGATCTGAGCCAGA
AACGATGACAGAGGAATCCCCATGAGACATAAAAATTCATTGTCTATGTTCCTGGTAATG
TCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCCCAA
GCAAGGGATTGGATAGAGGAGAAGTGATGAGGGTAGATAGCTGTAAAGTATGGATGAGTA
AAGAGAAAGTTAATCTTTTGTCATTTTTTTTCTTCATTTTACTCCCAGAATACATACCTC
CAAGGTGATTTCAGAGTTCTTCCTCAGTCTTGAGATTTGGGATTCCCGGTTTGTGTCAGT
AGAATTGCGAGAGTGTGAGTTCATCCTATTTTCTTCAGTACGATTTTTTTTCTTGCATGT
AATACCTCTTCCCTATGAGTTGATTATCTTGGAAGAGCAACTGTAGACAGTGGGTTATTA
AGGAACGCATAACAAAAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATGA
CAGAGGTACTGACCATTGCCAAAGATGCTCTAGAGTATAAAGTCCACTCAAGCATCTGGT
AGTTAATGTTAGTTTTCAATGGAAATCTAACCAGCACTACTAGTGATCAGCTGCTCAATA
CATGCAGCACAATTTAGAGCCTGGGGGGATGATGTTGGATCATTGATGACCATAAAAGAT
GTGGGAGTCGTCTGAAACATGCATGATGACCACATTATTGGGAGACTGAGGTCCACCTCA
TAATCTATGCACTGCATGATGGGATACTGGTTAGAGATGTTAGAAATAGTCCAATTTCAA
CAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGTGTCTACTGACACATAATCC
CACAAGTAGAGTGCAAATCATTTAGACCGGGTAGATCTGAGCCAGAAACGATGACAGAGG
AATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGT
TTTGCTGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGATA
GAGGAGAAGTGATCAAGGCAGATAGATAAATTATGGATGAGTAAAGAGAAAGTCAATCTT
TTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCATGT
TCTTCCTCAGTCTTGAGGTTTGGGATTCCCAGTGTGTGTCAGCAGAATTGTGAGAGTGTG
AGTTCATCCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGTATG
AATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATATGAAAA
AAATATGTTCCATGAACAGATTCCTATGAAGAGTGGGCAATGACAGAGGTAGTGACCACT
GCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAGGTTAGTTTTCA
ATGGAAATCTGACCAGCACTACTAGTGATCAGATGCTCAATAAACGCAGCACAATTTAGA
GCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAATCATCTGGGAGTCCTCT
GAGACATCCATGAAGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACT
GCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGGGTTTACA
TGTAGATTAATTAATATTTGGAAATCGTGTCTACTGATACATAATCCCATAAGTAGAGTG
CAAATCATTTAGACCGGGTAGATCTGTGCCAGAAACGATGAAGAGGAATCCCCATAAGAC
ATGGAAAATCATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGG
AAGACCAATCAAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTATTCA
AGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTCTCATTTTTT
TTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGT
CTTGAGGTTTGGGATACCCGGTTTGTGTCAGCAGAATTGTGTGAGTGTGAGTTCATCGTA
TTTTCTCAAGAACGATCTGTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTAT
CTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAACGAAATATGTT
CCAAACCGATTCCTATGAAGAGTGTGCAATGACAGAGGTAGTGACCACTGCCAAAGATGC
TCTAGAGTTTAAAGTCCACTCAAGCATCTGGTACTTAATGTTAGTTTTCAATGGAAATCA
AACCAGCAGTACTAGTGATCAGCTGCTCAATAAATGCAGCACAATTTAGAGCCTGGGGGG
ATGATGTTGGATCATTGATGAGCAAAAAAAAAAAAAAATAAACACCTGGGAGTCCTCTGA
GACATCCATGATGACCACAACATTGGGAGTCTGAGGTTCACATCATAATCTATGCACTGC
ATGCTGGGTTCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACATG
TAGATTAATTAAAATTTGGAAATCGTGTCTACTGACACATAATCCCATGAGTAGAGTGCA
AATCATTTTACCGGAGAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCAT
GGAAAATCATTGTCTATGTTCATGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAA
GAGCCAATCCAAGTGGATTGATAGCTCAAGGAAGGGATTGGATAGAGGAGAAGTGATCAA
GGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTT
CTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCATGTTCTTCCTCAGTCTT
GAGGTTTGGGATTCCTGGTTTGTGTAAGCAGAATTGTGAGAGTGTGAGTTCATCCTATTT
TCTTCAGAACGATTTTTTTCTCGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTG
GGAGATCATCTGTAGACGGTGGTTCAATAAGGAACGCCTATGACAATAATATGTTCCATG
AACAGATTCCTATGAAGAGTGGGCAATGAAAGAGGTAGTGACCACTGCCAAAGATGCTCT
AGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACC
AGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGTGGATGA
TGTTGGATCATTGATGACCAAAAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATG
ACCACAACATTTGGAGTCTGTGGTCCACATCATAATCTATGCACTGCATGCTGGGATACT
GGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAAT
ATTTGGAAATCGTGTCTACTGATACATAATCCCATAAGTAGAGTGCAAATCATTTAGACC
GGGTAGCTCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGACATGGAAAATCATTG
TCTATGTTCCTGGTGACATCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCAATCCAAT
TCGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGT
AAATTATGGATGAGTGAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACT
CTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGAT
TCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGAACGA
TTTCTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCATCTG
TAGACAGTGGTTCAATAAGGAACGCCTATGAAAATAATATGTTCTATTAACCGATTTCTA
TGAAGAGTATGCAATGACAGAGGTAGTGACCACTGCCAAAGATGCTCTAGCGTTTAAAGT
CCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAACCTAACCAGCAGTACTAG
TGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTGGGGGGATGATGTTGGATCAT
TGATGACCAAAAAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACAT
TGGTAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCCGGGATACTGGTTAGAGAT
GTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGGAAAT
CGTGTCTACTGATACATAATCCCATAAGTAGAGTGCAAATCATTTAGACCGGGTAGATCT
GAGCCAGAAACGATGACAGAGGAATCCCCATAAGACATGGAAAATCATTGTCTATGTTCC
TGTTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCAATCCAATTGGATTGATA
GCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGA
TGAGTGAAGAGAAAGTTAATCTTTTTGTCATTTTTTTGCTGCATTTTACTCTCAGAATAG
ATACCTCCAAGGGGATCTCCATGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCAGTGTG
TGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTC
GCATGTATTCCCTCTTCCGTTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGG
TTCAATAAGGAACGCATATGAAAAAAATATGTTCCATGAACAGATTCCTATGAAGAGTGG
GCAATGACAGAGGTAGTGACCACTGCCAAAGTTGCTCTCGAGTTTAAAGTCCACTCAAGC
ATCTGGTAGTTAATGTTAGTTTTCAATGGAAATTTAACCAGCACTACCAGTGATCAGATG
CTCAATAAACGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATAATTGATGACCAA
AAAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTG
AGGTCCACATCATAATCTATGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATA
GTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACT
GATACATAATCCCATAAGTAGAGTGCAAATCATTTAGACCGGGTAGATCTGAGCCAGAAA
TGATGAAGAGGAATCCCCATAAGACATGGAAATTCATTGTCTATGTTCCTGGTGACGTCA
GAGTCATGGGTTTTGATGTGTCAGGAAGACCAATCCAATTGGATTGATAGCTCAAGCAAG
GGATTGGATAGAGGAGAAGTATTCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAG
AAAGTTAATCTTTTTCTCATTTTATTTCTGCATTTTACTCTCAGAATAGATACCTCCAAG
GTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATACCCGGTTTGTGTCAGCAGAA
TTGTGTGAGTGTGAGTTCATCGTATTTTCTCAAGAACGATCTGTTTTCTTGCATGTATTC
CCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGG
AATGCATACGAAACAAAATATGTTCCAAACCGATTCCTATGAAGAGTGTGCAATGACAGA
GGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTACTT
AATGTTAGTTTTCAATGGAAATCAAACCAGCAGTACTAGTGATCAGCTGCTCAATAAATG
CAACACAATTTAGAGCCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAA
AAATAAGCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAG
GTCCACATCAGAATCTATGCACTGCATGCTGGGTTCCTGGTGAGAGATGTTAGAAATAGA
CTAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGTGTCTACTGA
CACATAATCCCATGAGTAGGGTTCAAATCATTTTGACCGGGTAGATCTGAGCCAGAAACG
AACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCATGGTGACGTCAGAG
ACATGGGTTTTGATGTGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGGAAGGG
ATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAA
AGTTAATCTTTTTGTCATTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTG
ATCTCCATGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCTGGTTTGTGTAAGCAGAATTG
TGAGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCCTC
TTCCGGTATGAATTTACTATCTTGGGAGATCATCTGTAGACAGTGGTTCAATAAGGAACG
CATATGAAAATAATATGTTCCATGAACAGATTCCTATGAAGAGTGGGCAATGACAGAGGT
AGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAAT
GTTAGTTTTCAATGGAAATCTGACCAGCACTACTAGTGATCAGATGCTCAATAAATGCAA
CACAATTTCGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAATCATCT
GGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGTGGTCCACATCATA
ATCTATGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACA
AGGAGTTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGATACATAATCCCA
TAAGTAGAGTGCAAATCATTTAGACCGGGTAGCTCTGAGCCACAAACGATGACAGAGGAA
TCCCCATAAGACATGGAAAATCATTGTCTATGTTCCTGGTGACATCAGAGTCATGGGTTT
TGATGTGTCAGGAAGACCAATCCAATTCGATTGATAGCTCAAGCAAGGGATTGGATAGAG
GAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTGAAGAGAAAGTTAATCTTT
TTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGT
TCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTG
AGTTCATCCTATTTTCTTCAGAACGATTTCTTTCTTGCATGTATTCCCTCTTCCGGTATG
AATTTAGTATCTTGGGAGAGCATCTGTAGACAGTGGTTCAATAAGGAACGCCTATGAAAA
TAATATGTTCTATTAACCGATTTCTATGAAGAGTATGCAATGACAGAGGTAGTGACCACT
GCCAAAGATGCTCTAGCGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTC
AATGGAAATCTAACCAGCAGTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAG
AGCCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAAAATAAACATCTG
GGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAA
TCTATGCACTGCATGCTGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAG
CAGTTTACATGTAGATTAATATTTGGAAATCGTGTCTACCGACACATAATCCCATAAGTA
GAGTGCAAATCATTTTGACCGGGTAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCA
TAAGCCATGGAAAATCATTGTCTATGTTCCTGGTGACGACAGAGTCATGGGTTTTGATGT
CTCAGGAAGACCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAG
TGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCA
TTTTTTTCCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCC
TCAGTCTTGAGGTGTGGGATTCCCGGTGTGTGTCATCAGTTTTATTGTGAGAGTGTGAGT
TCATCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCTGGTATAATTT
AGTATCTTGGAAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAATATA
TGTTCCATGAACTGATACCTTCGTAGAGTGTGCAATGACAGAGGTAATGACCACTGCCAA
AAATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGG
AAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAGTCT
TGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAAAAAAAACATCTGGGAGT
CCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACACATAATCTATG
CACTGCATGCTGGGATACTGGATAGAGATGTTAGAAATAGTCCAATTTCACCAAGGAGTT
TACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGATACATAATCCCATAAGTAG
AGTGCAAATCATTTTGACCGGGTAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCAG
TAGACATGGAAAATCATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTG
TCAGGAAGACCAATCAAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGACGT
GATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTCAATCTTTTGTCATT
TTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGTTCTCCATGTTCTTCCTC
AGTCTTGAGGTTTGGGATTCCTGGTTTGTGTAAGCAGAATTGTGAGAGTGTGAGTTCATC
CTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCCTCTTCCGGTGTGAATTTAGT
ATTTTGGGAGATCATCTGTAGACAGTGGTTCAATAAGGAACGCATATGAAAATAATATGT
TCCATGAACAGATTCTTATGAAGAGTGGGCAATGACAGAGGTAGTGACCACTGCCAAAGA
TGCTCTAGAGTTTAAAGTCCACACAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAA
TCTGACCAGCACTACTAGTGATCAGATGCTCAATAAATGAAGCACAATTTAGAGCCTGGG
TGGATGATGTTGGATCATTGATGACCAAAAAAAAATCATCTGGGAGTCTTCTGAGACATC
CATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTAAGCACTGCATGGTG
GGATACAGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACAAGTAGATT
AATTAATATTTGGAAATCGTGTCTACTGATACATAATCCCATAAGTAGAGTCAAAATCAT
TTAGACCGGGTAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGACATGGAAA
ATAATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCA
ATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTATTCAAGGCAGA
TAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTTTCTG
CATTTTACTCTCAGAATAGATACCTCCAAGGTAATCTCCAAGTTCTTCCTCAGTCTTGAG
GTTTGGGATACCCGGTTTGTGTCAGCAGAATTGTGTGCGTGTGAGTTCATCCTATTTTCT
CAAGAACGATTTGTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGG
AGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAAATATGGTCCAAAC
CGATTCCTATGAAGAGTGTGCAATGACAGAGGTAGTGACCACTGCCAAAGATGCTCTAGA
GTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTCCAATGGAAATCTAACCAG
CAGTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAGCCTTGGTGGATGATG
TTGGATCATTGATGACCAAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGATATCCAT
GATGACCACAACATTGGGAGTCTGAGGTCCACACATAATCTATGCACTGCATGCTGGGAT
ACTGGATAGAGATGTTAGAAATAGTCCAATTTCAACAAGCAGTTTACATGTAGATTAATA
TTTGGAAATCGTGTCTACCGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCG
GGTAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGT
CTATGTTCCTGGTGACGACAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCATCCAATT
GGATTGAAAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTA
AATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCCTGCATTTTACTC
TCAGAATAGATACCTCCAAGGTGATCTCCAAATTCTTCCTCAGTCTTGAGGTGTGGGATT
CCCGGTGTGTGTCATCAGTTTTATTGTGAGAGTGTGAGTTCATCTATTTTCTTCAGATCG
ATTTTTTTCTTGCATGTATTCCCTCTTCCGGTATAATTTAGTATCTTGGAAGAGCAACTG
TAGACAGTGGTTCAATAAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTT
CGTAGAGTGTGCAATGACAGAGGTAATGACCACTGCCAAAAATGCTCTAGAGTTTAAAGT
CCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTAGTAG
TGATCAGCGGCTCAATAAATGCAGCACAATTTAGAGCCTTGGTGGATGATGTTGGATCAT
TGATGACCAAAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCA
CAACATTGGGAGTCTGAGGTCCACACATAATCTATGCACTGCATGCTGGGATACTGGATA
GAGATGTTAGATATAGTCCAATTTCACCAAGGAGTTTACATGTAGATTAATTAATATTTG
GAAATCGTGTCTACTGATACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGTA
GATCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGACATGGAAAAACATTGTCTAT
GTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCAATCAAATTGGAT
TGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTATTCAAGGCAGATAGATGTAAATT
ATGGATGAGTAAAGAGAAAGTTAAACTTTTTCTCATTTTTTTTCTGCATTTTACTCTCAG
AATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATACCCG
GTTTGTGTCAGCAGAATTGTGTGAGTGTGAGTTCATCGTATTTTCTCAAGAACGATATGT
TTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGA
CAGTGGTTCAATAAGGAACGCATATGAAAATAATATGTTCCATGAACAGATTCCTATGAA
GAGTGGGCAATGACAGAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAC
TCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAATCTGACCAGCACTACTAGTGAT
CAGATGCTCAATAAATGCAGCACAATTTAGAGTCTGGGTGGATGATGTTGGATCATTGAT
GACCAAAAAAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGT
AAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATACTGGTGAGAGATGTT
AGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGGAAATCGT
GTCTACTGATACATAATCCCATAAGTAGAGTGCAAATCATTTAGACCGGGTAGATCTGAG
CCACAAACGATGACAGAGGAATCCCCATAAGACATGGAAAATCATTGTCTATATTCCTGG
TGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCAATCCAATTGGATTGATAGCT
CAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGA
GTGAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATA
CCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGT
CAGTAGAATTGTGAGTGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTCTTTCTTGCA
TGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCATCTGTAGACAGTGGTTC
CATAAGAAACGCCTATGAAAATAATATGTTCTATTAACCGATTTCTATGAAGAGTATGCA
ATGACAGAGGTAGTGACCACTGCCAAAGATGCTCTAGCGTTTAAAGTCCACTCAAGCATC
TGGTAGTTAATGTTAGTTATCAATGGAAATCTAACCAGCAGTACTAGTGATCAGCTGTTC
AATAAATGCAGCACAATTTAGAGCCTGGGGGGATGATGTTGGATCATTGATGACCTAAAA
AAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGG
AGTCTGAGGTCCACATCATAATCTGTGCACTGCATGCTCGGATACTGGTTAGAGATGTTA
GAAATAGTCCAATTTCAACAAGCAGTTTACATGTAGATTAATATTTGGAAATCGTGTCTA
CCGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGTAGATCTGAGCCAGA
AACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGACA
TCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAA
GCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGAATGCTGTAAATTATGGATGAGTA
AAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCAGAATACATACCT
CCACGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAG
TAGAATTGCGAGAGTGTGAGTTCATCCTATTTTCTTCAGTACGATTTTTTTTTCTTGATG
TAATGCCTCTTCCCCTATGAGTTGATAATCTTGGGAGAGCAACCGTAGACATTGGTTAAT
TAAGGAACGCATACTAAAAATATATGTTCCCTGAACTGATACCTTCGAAGAGTATGCAAT
GACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTG
GTAGTTAATGTTAGTTTTCAATGGAAATCTAACCACCAGTACTAGTGTTAAGCTTCTCAA
TAAATGCAGCACAGTTTAGAGCCTGGGGGTGATGATGTTGGATCATTGATGACCATAAAA
GATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACTTTGCGAGTCTGAGGTCCACA
TCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTT
GAATATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATA
AACCCATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGAC
AGAGGGATCCCAATAAGCCATGGAAAGTCATTGTCTTTGTTCCTGGTGACGTCAGAGTCA
TGGGTTTTGATGTGTCAGGAAGACCAATCCAATTGGATTGATAGCTCAAGCAAAGGATTG
GATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTGAAGAGAAAGTT
AATCTTTTTGTCATTTTTTTTTCTGCATTTTACTCTCAGAAAAGATACCTCCAAGGTGAT
CTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTG
AGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTCTTTCTTGCATGTATTCCCTCTT
CCTGTATGAATTTAGTATCTTGGGAGAGCATCTGTAGACAGTGGTTCAATAAGGAACGCC
TATGAAAATAATATGTTCCATGAACCGATTTCTATGAAGAGTATGCAATGACAGAGGTAG
TGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGT
TAGTTGTCAATGGAAATCTGACCAGCAGTACTAGTGATCAGCTGCTCAATAAATGGAGCA
CAATTTAGAGCCAGGGGGGGATGATGTTGGATCATNGATGCCCAAAAAAAAAAAAAAAAA
ACANCTGGGAGTCCTCTGAGACATCCATGATATCCACAACATTGGGAGTCTGAGGTCCAC
ATCATAATCTATGCACTGCATGCTGGGATACTGGTCAGAGATGTTAGAAATAGACTAATT
TGAATAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGTGTCTACTGACACATA
ATCCCATAAGTAGAGTGCAAATCATTTTGACCAGGTAGATCTGAGCCAGAAACGATGACA
GAGGAATCCCCATAAGCCTTGGAAAATCATTGTCTATGTTCATGGTGACGTCAGAGTCAT
GGGTTTTGATGTGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGGAAGGGATTG
GATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAATGTT
AATCTTTTTGTCATTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCT
CCATGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCTGGTTTGTGTAAGCAGAATTGTGAG
AGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCCTCTTCC
TGTATGAATTTAGTATCTTGGGAGATCATCTGTAGACAGTGGTTCAATAAGGAACGCATA
TGAAAATAATATGTTCCATGAACAGATTCCTATGAAGAGTGGGCAATGACAGAGGTAGTG
ACCACTGCCAAAGATGCTCTAGCGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTA
GTTTTCAATGGAAATCTGACCAGCACTACTAGTGATCAGATGCTCAATAAATGCAGCACA
ATTTAGAGTCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAATCATCTGGGAG
TCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTA
TGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAG
TTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGATACATAATCCCATAAGT
AGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATCCCC
ATAAGACATGGAAAATCATTGTCTATGTTCCTGGTGACATCAGAGTCGTGGGTTTTAATG
TGTCAGGAAGACCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAA
GTATTCAAGGCAGATAGATTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTCTCA
TTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCC
TCAGTCTTGAGGTTTGGGATACCCGGTTTGTGTCAGCAGAATTGTGTGAGTGTGAGTTCA
TCCTATTTTCTCAAGAACGATTTGTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTT
AGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAAAT
ATGGTCCACACCGATTCCTATGAAGAGTGTGTAATGACAGAGGTAGTGACCACTGCCAAA
GATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGA
AATCTGACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAGCCTG
GTGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAACCAAACATCTGGGAGTCC
TCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGC
TCTGCATTCTGGGATCCTGGTTAGAGATGTTAGAAATAGTCCTATTTCAACAAGGAGTTT
ACATGTAGATTAACTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGA
GTGCAAATCATTTTGACCGGGTAGATCTGAGCCAGAAACGATGACAGAAATCCCCATAAG
ACATGGAAAATCATTGTCTATGATCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCA
GGAAGACCAATCAAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGAT
CAAGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTCAATCTTTTGTCATTTTT
TTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCATGTTCTTCCTCAGT
CTTGAGGTTTGGGATTCCTGGTTTGTGTAAGCAGAATTGTGAGAGTGTGAGTTCATCCTA
TTTTCTTCAGTATGATTTTTTTCCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATAAT
CTTGGGAGAGCAACTGTAGACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTC
CATGAACTGATACCTATGAAGAGTGTGCAATGACAGATGTAATGACCTTTGCCAAAGATG
CTCTAGAGTTTAAAATCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAATC
TAACCAGCACTACTAGTGTTCAGCCTCTCAATAAATGCAGCCCAGTTTAGAGCCTGGGGG
GGATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGA
TGACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATACTGGGATC
CTGGTGAGAGATGTTAGGAACAGTCTACTTTGAGCATGTAGTTTTAATGTAGATTAAAGA
AAAAATTGGAAATTGTGTCTACTAAGACATAATCCCATAGGTAGTGTGCTAATCATCTTT
ACCGGGTAGTTTCTAAGTCAGAAACGATGACAGAGGGATCCCAATAAGCCATGGAAAGTC
ATGGACTATGTTCCTGGTGACGTCAGAGTCATGGGCTTTGATGTGTCAGGAAGAGCCAAT
CCAATTGGATTGATAATTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATA
GATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCTGCATTT
TACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTG
GGATTCCCGGTTTGTGTCAGCACAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGA
ACGATTTTTTTCTTGCATGTATTCCCTTTTCCGGTATGAATTTAGTATCTTGGGAGAGCA
TCTGTAGACAGTGGTTCAATAGGAACGCCTAAGAAAATAATATGTTCCATGAACCGATAT
CTATGAAGAGTATGCAGTCACAGAGGTAGTGACCACTGCCAAAGGTGCTCTAGAGTTTAA
AGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAATATGACCAGCACTAC
TAGTGATCAGCTCTTTAATAAATGTAGCACAATTTAGAGCCTGGGTGGATGATGTTGGAT
CATTGATGACCAAAAAAAATAATCATCTGCGAGTCCTCTGAGACATCCATGATGACCACA
TCATTGGGATCTGAGGTCCACATCATAATCTATACACTGCATGCTGGGATACTGGTTAGA
GATGTTAGATATAGTCCAATTTAGCAAGGAGTTTACATGTAGATTAATTAATATTTGGAA
ATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGTAGAT
CTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATATT
CCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCATCCAATTGGATTG
ATAGCTCAAGGAAGGGATCGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTAT
GGATGAGTAAAGAGAAACTTAATCTTTTTGTCATTTTTTTTTCTGCATTTTACTCTCAGA
ATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGATGTGTGGGATCCCGGT
GTGTGTCAGCAGTATTTTGAGAGTGTGAGTTCATCTATTTTCTTCATTTCGATTTTTTTC
TTGCATGTATTCCCTCTTCCATCAAAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTG
GTTCAATAAGGAACGCATACGAAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGAG
TGCAATGACAGAGGTAGTGAACACTGCCAAAGGTGCTCTAGAGTTTAAAGTCCAGTCAAG
CATTTGGTAGTTAATGTCAGTTTTAAATGCAAATCTAACCAGCACTACTAGTGATCAGCG
GTCAATAAATGCACCACAATTTAGAGCCTGGGTGGATGATGTTGGATCTTTGATGACCAA
AAAAAAAAAAAAAAAACCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTG
GGAGTCTGAGGTCCACACCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGT
TAGAAATAGACTAATTTGAATAAGGAGTTTACATGTAGATTAAATAAAATTCGGAAATCG
TGTCTACTGACACATAATTTCATAAGAAGAGTGCCAATCATTTTGACCGGGGGGAACTTA
GCCAGAAACGATGACAGAGGAATCCCCATAAGCCATTGAAAATCATTGTCTATGTTCCTG
GTGACGTCAGAGTCATGGTGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTAGATTGAT
AGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATTT
ATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCTCAGAATA
GATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGCTTCCCGGTTT
GTGTCAGCACAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCT
TGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCCTGGGAGAGCATCTGTAGACAGTG
GTTCTTTAAGGAACGCCTAAGAAAATAATATGTTCCATGAACAGATTTCTATGAAGAGTG
TGCAATGACAGAGGTAGTGATCACTGCCAAAGATGCTCTAGAGTTTAAGTCCACTCAAGC
ATCTGGTAGTTAATATTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTC
TCAATAAATGCAGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGTCCAT
AAAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTC
CACATCATAATTTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACCGTCTA
CTTTGAACATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTTTACTAAGA
CATAATCCCATAGGAAGAGTGCTAATCAACTTGACCGGGTAGTATCTGAGTCAGGAACGA
TGACAGGGGATCACAATAAGCCATGGAAAATCATTGTCTATGTTCCTGGTGACGTCAGAG
TCATGGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGT
ATTGGATAGAGGAGAAGTGATCAAGGCGGATAGATGTAAATTATGGATGAGTAAAGAGAA
AGTTAATCTTTTTGTAATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGT
GATCTCCACGTTCTTCCTCAGTATTGAGTTTTGGGATTCCGGTTTCTGTCATTAGAATTG
TGAGAGTGTGAGTTCATCCTATTTTCCTCAGAACGATTTTTTTCTTGCATGTATTCCCTC
TACCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGACCG
CCTATGAAAATAATATGTTCCATGAACCGATTTCTATGAAGAGTATGCAATGACAGAGGT
AGTGACCACTGCCAAAGGTGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAAT
GTTAGTTTTCAATGGAAATATGACCAGCACTACTCGTGATCAGCTCTTTAATAAACGCAG
CACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAATCATCT
GCGAGTCCTCTGAAACATCCATGATGTCCACATCATTGGGAGTCTGAGGTCCACATCATA
ATCTATACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACA
AGGACTTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCA
TAAGTAGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACAATGACAGAGGAA
TCCCCATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTT
TTGATGTGTCAGGAAGACCCATCCAATTGGATTGATAGCTCAAGCAAGGGATCGTATAGA
GGAGAAGTGTTCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTA
TTTGTCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAA
GTTCTTCCTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGGAGTATTTTGAGAGTGT
GAGTTCATCTAGTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATA
ATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACAAAAAA
ATATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGC
CAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAA
TAGTAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAG
CCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAATCTGGGAGTCCTCT
GAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACT
GCATGCTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACA
TGTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTG
CCAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAACA
CATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCA
GGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGA
TCAGGGCAGATAGCTGTAAATTATGGATGATTAAAGAGAAAGTTAATCTTTTTGACATTT
TTTTTTCTGCCTATGCAGGATGCTCCCGTCACACAGTGTGTCCATTCTATGGGCTACTGA
ACAGAGAAGATGACAAAATCAAGGCTCTCCCTGTAATGGCTTACACTGCGCACCTACCAC
TGGCCACTAGGCCAGCTAATTTTTGGAGTATATTTAATGTTCTGATTGCTTAAAGAGATG
GAATTTTCAAACATCCTCAGAATGAAGACATTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAGNNNNNNNNNNTNGGGATTCCCCGGTTTGTGTCAGT
AGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCTTGCATGT
AATGCCTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTTAAAT
AAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATG
ACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTATAAAGTCCACTCAAGCATCTGG
TAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTTGTGATCAGCTTCTCAATA
AATGCAGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGA
TGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATC
ATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTACTTTGA
GCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAAA
CCCATAGGAAGAGTGCGAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACAG
AGGGATCCCAATAAGCCATGGAAAGTCATTGTCTATGTACCTGGTGACGTCAGAGTCATG
GGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGG
ATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGACGAGTAAATAGAAAGTTA
ATCTTTCCGGCCTTTTTTTTTTGCATTTTATTCTCAGAATAGATACCTCCAACGTGATCT
CCAAGTTCTTCCTCAGGCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAG
AGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTC
CGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTAGTTCAATAAGGAACGCAT
ACGAAAAAAAATATGTTCAAACCGAATCCTTGTAGAGTATGCAATGACAGAGGTAGTGAC
CACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGT
TTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAAT
TTAGAAGCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAACATCTGGGA
GTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCT
ATACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAATGA
GTTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAG
TAGAGTGCAAATCATTTTGAACGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATCCC
CATAAGCCATGGAAAATCATTCTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGA
TGTGTCAGGAAGACCCATCCAATTGGATTGATAGCTCAAGCAAGGGATCGTATAGAGGAG
AAGTGTTCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTG
TCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTC
TTCCTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGGAGTATTTTGAGAGTGTGAGT
TCATCTAGTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATAATTT
AGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACAAAAAAATAT
GTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGCCAAA
GATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGT
AATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTG
GGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAAACATCTGGGAGTCCTCTG
AGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTG
CATGGTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACAT
GTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGC
CAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAAGCC
ATGGAAAATCATTGTCTATGTTCCTAGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGG
AAGAGCCATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCA
AGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTT
TTCTGCCTTTTACTTCCAGGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTC
CTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCTAT
TTTCTTCAGTTCGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATTATC
TTGGGAGAGCAACTGTAGACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTCC
ATGAACTGATACCTATGAAGAGTGTGCAATGACAGAGGTAATGACCTTTGCCAAAGATGC
TCTAGAGTATAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTA
ACCAGCACTACTTGTGATCAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGGGG
ATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATG
ACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCT
GGTGAGAGATGTTAGGAACAGTGTACTTTGAGCATGGAGTTTTAATGTAGATTAAAGAAA
AAATTGGAAATTGTGTTTACTAAGACATAATCCCATAGGAAGAGTGCTAATCAACTTGAC
CGGGTAGTGTCTGAGTCAGAAACGATGACAGAGGGATCACAATAAGCCATGGAAAGTCAT
TGTCTATGTTCCTGGTGACGTCAGTGTCATGGGTTTTGATGTGTCAGGAAGAGCCAATCC
AATTGGATTGATAGCTCAAGCAAGGTATTGGATAGAGGAGAAGTGATCAAGGCAGATAGC
TGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTTTCATTTTTTTTCTACATTTT
ACTCTCATAATATATACCTCCAAGGTGATATCCAAGTTCTTCCTCAGTCTTGAGGTCTGG
TATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAA
CGATTCTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCA
ACTGTAGACAGTAGTTCAATAAGGAACGCATACGAAAAAAAATATGTTCAAACCGATTCC
TATGAAGAGTATGCAATGATATAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAA
GTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACT
AGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGTGATGATGTTGGATC
ATTGATGACCAAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACC
ACAACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGGGATACTTGT
TAGAGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATT
TGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGG
GAGATCTGAGCCAGAAATGACGACAGAGGAATCCCCATAAGTCATGGAAAATCATCGTCT
ATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGACCCATCCAATGG
GATTGATAGCTCAAGCAAGGGATCGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAA
ATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTTCTGCATTTTACTC
TCAGAAAAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTGTGGGATC
CCGGTGTGTGTCAGGAGTATTTTGAGAGTGTGAGTTCATCTATTTTCTTCAGATCGATTT
TTTTCTTGCATGTATTCCCTCTTCCGGCATAATTTAGTATCTTGGGAGAGCAACTGTAGA
CAGTGGTTCAATAAGGAAAGCATACGAAAAAATATGTTCCATGAACCGATTCCTATGAAG
AGAGTGCAATGAAAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGT
CAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATC
AGCCGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATG
AACAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGG
AGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTA
GGAATAGACTAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTG
TCCACTGACACATAATCCCATAAGAAGAGTGCCAATCATTTTGACCGGGGAGAACTTAGC
CAGAAACGATGACAGAGGAATCCCCATAACACATGGAAAATCATTGTCTATGTTCATGTT
GACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGC
TCAAGCAAGGGATTTGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAATTATGGATG
AGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCTGCCTTTTACTCCCAGAATACATA
CCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGT
CAGTAGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCTTGC
ATGTAATGCCTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTT
AAATAAGGAACGCATACGAAAAATATATGTTCCAAGAACTGATCCCTATGAAGGGTGTGG
AATGACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCAT
CTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTC
AATAAATGCAGCCCAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAA
AAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCA
CATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTACT
TTGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTTTACTAAGACA
TAATCCCATAGAAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATG
ACAGAGGGATCACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGTTGACGTCAGAGT
CATGGGTTTTGATGTTTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGTA
TTGGATAGAGGAGATGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAA
GTTAATCTTTTTGTCATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTG
ATCTCCAAGTTCTTCCTCTGTTGAGGTGTGGGATCCTGGTGTGTTTCAGCAGTATTTTGA
GAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCCTCTTC
CGGCATAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAATGCATA
CGAAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAAGTAGTG
AACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTA
GTTTTCAATGGAAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACA
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCNTNNNNNNNNNNNNTNNGAGANGNNNNATATNNNNNNNNNN
NNNNNNGGNGTTNNNNTGTAGATTAATNNNNATNNGGANANNNNNNNNNNTGACNNANNN
NNCCNTAAGTAGAGTGCANNTCNTNNNGNNNGNGGAGATATGAGCCAGAAACGATGACAG
AGGNNTCCCCATAAGCCATGGAAAATCATNGTCTATATTCCTGTATGACGTCAGAGTCAT
GGGTTTTGATGTGTCAGGAAGACCCATCCAATGGGATTGATAGCTCAAGCAAGGGATCGG
ATAGAGGAGAAGTTATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTA
ATCTATTTGTCATTTTTTTTTTCTGCATTTTACTCTCAGAATAGATAACTCCAAGGTGAT
CTCCAAGTTCTTCCCCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGCAGTATTTTGA
GAGTGTGAGTTCATCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCC
GACATAATTTAGTATCTTATGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATAC
GAAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGAAAGAGGTAGTGA
ACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAG
TTTTAAATGGAAATCAAACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAA
TTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAACATCTGGG
AGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATC
TATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGG
AGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAA
GAAGAGTGCCAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCC
CCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTT
ATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGG
AGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTT
TGTCATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTT
CTTCCTCTGTTGAGGTGTGGGATCCTGGTGTGTTTCAGCAGTATTTTGAGAGTGTGAGTT
CATCCTATTTTCTTCAGAACGATTTTTTTCTTGCACGTATTCCCTCTTCCGGCATAATTT
AGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAATGCATACGAAAAAAATA
TGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAAGTAGTGAACACTGCCAA
AGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTCAATGG
AAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCT
GGGTGGTTGATGTTGGATCATTGATGACCAGAAAGAAATCATCTGGGAGTCCTCTGAGAC
ATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTGCATG
CTGGGATACTGGTTAGAGATCTTAGATATAGTCCAAGGATTTCAACAAGGAGTTTACATG
TAGATTAATTAAAATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCA
AATCATTTTGACCGGAGAGATCTGAGCCAGAAATGACGACAGAGGAATCCCCATAAGCCA
TGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGG
AAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATC
AGGGCAGATAGCTGTAAATTATGGATGATTAAAGAGAAAGTTAATCTTTTTGACATTTTT
TTTCTGCCTTTTACTCCCAGAATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGT
CCTGAGGTTTGGGATTCCCGGTTTGTCTCAGTAGAATTGCGAGAGTGTGAGTTCATCCTA
TTTTCTTCAGTATGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATAAT
CTTGGGAGAGCAACTGTAGACAGTGGTTAATTAAGGAACCCATACGAAAAATATATGTTC
CATGAACTGATCCCTGTGAAGAGTGTGGAATGACAGAGGTAATGACCTTTGCCAAAGATG
CTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTACTTTTCAATTGAATCT
AACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCCCAGTTTAGAGCCTGGGGGG
GATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGAT
GACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCC
TGGTGAGAGATGTTAGGAACAGTCTACTTTGAACATGGAGTTTTAATGTAGATTAAAGAA
AAAATTGGAAATTGTGTCTACTAAGACATAAACCCATAGGAAGAGTGCTAATCATCTTGA
CCGGGTAGTATCTGAGTCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAGTCA
TTGTCTATGTTCCTGGGGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCAATC
CAATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAG
ATGTAAATTATGGATGAGTAAAGGGAAAGTTAATCTTTCTGTCATTTTTTTTCTGCATTT
TATTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTG
GGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGA
ACGATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTCGGGAGAGC
AGCTGTAGACAGTAGTTCAATAAGGAACGCATACGAAAAAAAATATGTTCAAACCGAATC
CTTGTAGAGTATGCAATGACAGAGGTAGTGACCAGTGCCAAAGATGCTCTAGAGTTTAAA
GTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACT
AGTGATCAGCGGCTCAAAAAATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGATC
ATTGATGACCAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCAC
AACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGGATACTGGTTAG
AGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGG
AAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGAGAG
ACTTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATA
TTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCCATCCAATGGGAT
TGATAGCTCAAGCAAGGGATCGGATAGAGGAGAAGTTATCAAGGCAGATAGATGTAAATT
ATGGATGAGTAAAGAGAAAGTTAATCTATTTGTCATTTTTTTTTTCTGCATTTTACTCTC
AGAATAGATAACTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTGTGGGATCCC
GGTGTGTGTCAGCAGTATTTTGAGAGTGTGAGTTCATCTATTTTCTTCAGATCGATTTTT
TTCTTGCATGTATTCCCTCTTCCGACATAATTTAGTATCTTATGAGAGCAACTGTAGACA
GTGGTTCAATAAGGAACGCATACGAAAAAAATATGTTCCATGAACCGATTCCTATGAAGA
GAGTGCAATGATAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTC
AAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCAAACCAGCACTACTAGTGATCA
GCTGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGA
CCAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGA
GTCTGAGGTCCACATCATAATCTATGCACTGCAAGCTGGGATCCTGGTGAGAGATGATAG
AAATAGACTAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGT
CCACTGACACATAATCCCATAAGAAGAGTGCCAATAATTTTGACCGGGGAGAACTGAGCC
AGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTG
ACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCT
CAAGCAAGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAG
TAAAGAGAAAGTTAATCTTTTTGTCACATTTTTTCTGCCTTTTACTTCCAGGATACATAC
CTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTC
AGTAGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCTTGCA
TGTAATGCCTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTTA
AATAAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCA
ATGACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATC
TGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCA
ATAAATGCAGCCCAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAA
AGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATGGCGAGTCTGAGGTCCAC
ATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTACTT
TGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTTTACTAAGACAT
AATCCCATAGGAAGAGTGCTAATCAACTTGACCGGGTAGTGTCTGAGTCAGAAACGATGA
CAGAGGGATCACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGTGACGTCAGAGTC
ATGGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGAT
TGGATNGAGGAGAAGTGATNNNGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAG
TTAATCTTTTTGTCCTTTTTATTCTGCATTTTATTCTCAGAATAGATACCTCCAAGGTGA
TCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGT
GAGAGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTC
TTCCGGTATGAATTTAGTATCTCGGGAGAGCAGCTGTAGACAGTAGTTCAATAAGGAACG
CATACGAAAAAAAATATGTTCAAACCGAATCCTTGTAGAGTATGCAATGACAGAGGTAGT
GACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTT
AGTTTTAAATGGAAATCAAACCAGTACTACTAGTGATCAGCTGTTCAATAAATGCAGCAC
AATTNNNNNNCTNGNNNGATGATGTTGGATCATTGATGACCAAAAAAAAAAAACANCTGG
GAGTCCTCTGAGACNNNNNNGATGNNNNNNNNNNTNNNNNTCTGANNNNNNNATCATNNT
CTATNNNNNNCAANNNNNNNNNCTNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTANGN
NNNNNGATNANNNNNNNNTNNNANNNNNNNNGNNTCNNNNNNNNNNNANNNNNNNGACCN
AGACATCNNNNNNNNTANNNNNNNNNNNNNNNNNATNNNNNNNTCCNNTCATAGNNNNNN
NGAAACATTATTAGTTACTCAATAGATTNNTTAACACACAGTATAGAAATAAGTGAAGGG
GTGTCAGGGGATGAATTCTGACTGAATGTCATGTGTTTATAACTCTGAGGTCTAACGGGA
TGGATATGTTAAGAAGCAAGGGTTGGAGGGGGTGAGTGTAGTTTTTCGTCCCCTGCTCTG
ATCTGTACTCTTCAGAATGGAATGATGACCACAACATTGCGAGTCTGAGGTCCACATCAT
AATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTTGAAC
ATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAAACC
CATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACAGAG
GAATCCCCATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGGGACGTCAGAGTCATGGG
TTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGAT
AGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAACTTAAT
CTTTTTGTCATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCC
AAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAG
TGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTCCG
GTATGAATTTAGTATCTCGGGAGAGCAGCTGTAGACAGTAGTTCAATAAGGAACGCATAC
GAAAAAAAATATGTTCAAACCGAATCCTTGTAGAGTATGCAATGACAGAGGTAGTGACCA
GTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTT
TAAATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAAAAAATGCAGCACAATTT
AGAACCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAACATCTGGGAG
TCCTCTGAGACATCCATGATGACCATAACATTGGGAGTCTGAGGTCCACATCATAATCTA
TACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAG
TTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGT
TGAGTGCAAATCATTTTGACCGGAGAGACTTGAGCCAGAAACGATGACAGAGGAATCCCC
ATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGAT
GTGTCAGGAAGACCCATCCAATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAGGAGA
AGTTATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTGT
CATTTTTTTTTCTGCATTTTACTCTCAGAATAGATAACTCCAAGGTGATCTCCAAGTTCT
TCCTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGCAGTATTTTGAGAATGTGAGTT
CATCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCCTCCGACATAATTTA
GTTCTTATGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAATATG
TTCCATGAACCGATTCCTATGAAGAGAGTGCAATGATAGAGGTAGTGAACACTGCCAAAG
ATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAA
ATCAAACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTGG
GTGGATGATTTGGATCATTGATGACCAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAG
ACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTGCA
AGCTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACATGT
AGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGCCA
ATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCAT
GGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGA
AGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCA
AGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTT
TTCTGCCTTTTACTTCCAGGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTC
CTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCTAT
TTTCTTCAGTTCGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATAATC
TTGGGAGAGCAACTGTAGACAGTGGTTAATTAAGGAACCCATACGAAAAATATATGTTCC
ATGAACTGATCCCTATGAAGAGTGTGGAATGACAGAGGTAATGACCTTTGCCAAAGATGC
TCTAGAGTTTAAAGTCCACACAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTA
ACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCTCAGTTTAGAGCCTGGGGGGG
ATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATG
ACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCT
GGTGAGAGATGTTAGGAACAGTCTACTTTGAACATGGAGTTTTAATGTAGATTAAAGAAA
AATTGGAAATTGTGTCTACTAAGACATAAACCCATAGGAAGAGTGCTAATCATCTTGACC
GGGTAGTGTCTGAGTCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAGTCATT
GTCTATGTTCCTTGGGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCAATCCA
AGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGAT
GTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTCTGTCATTTTTTTTCTGCATTTTA
TTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGG
ATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAAC
GATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGACTTTAGTATCTTGGGAGAGCAA
CTGTAGACAGTAGTTCAATAAGGAACGCATACGAAAAAAAATATGTTCAAACCGAATCCT
TGTAGAGTATGCAATGACAGAGGTAGTGACCAGTGCCAAAGATGCTCTAGAGTTTAAAGT
CCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAG
TGATCAGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGATCAT
TGATGACCAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACA
ACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGGGATACTGGTTAG
AGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGG
AAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGGAG
ATCTGAACCAGAAACGATGACAGAGGAATCCCCATAAGTCATGGAAAATCATTGTCTATA
TTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCCATCCAATGGGAT
TGATAGCTCAAGCAAGGGATGGGATAGAGGAGAAGTGATCAAGGCAGTAAGATGTAAATT
ATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTATTTTTTCTGCATTTTACTCTCA
GAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTGTGGGATCCCG
GTGTGTGTCAGGAGTATTTTGAGAGTGTGAGTTCATCTATTTTCTTCAGATCGATTTTTT
TCTTGCATGTATTCCCTCTTCCGGCATAATTTAGTATCTTGGGAGAGCAACTGTAGACAG
TGGTTCAATAAGGAAAGCATACGAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGA
GTGCAATGAAAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAA
GCATTTGGTAGTTANNNNNNNNNNTAAATGGAAATCTAACCAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCATAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTGGTTCA
ATAAGGAAAGCATACGAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAAT
GAAAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTG
GTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCCGTTCAA
TAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGAACAAAAAAA
AAAAACATCTGGGAGTCCTCTGAGATATCCATGATGACCACAACATTGGGAGTCTGAGGT
CCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAATAGACT
AATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACA
CATAATCCCATAAGAAGAGTGCCAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGAT
GACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAG
TCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGG
GATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGA
AAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCAGGATACATACCTCCAAGG
TGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAAT
TGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCTTGCATGTAATGC
CTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTTAAATAAGGA
ACGCATACGAAAAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATGACAGA
GGTAATGAACTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTT
AATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGC
AGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGATGTGG
GAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATCATAAT
CTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTACTTTGAGCATG
GAGTTTTAATGTAGATAAAGAAAAAATTGGAAATTGTGTTTACTAAGACATAATCCCATA
GGAAGAGTGCTAATCAACTTGACCGGGTAGTGTCTGAGTCAGAAACGATGACAGAGGGAT
CACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTT
GATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGTATTGGATAGAG
GAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTTATCTTT
TTGTCATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGT
TCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTG
AGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTAT
GAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTAGTTCAATAAGGAACGCATACGAAA
AAAAAATATGTTCAAACCGATTCCTATGAAGAGTATGCAATGATACAGGTAGTGACCACT
GCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTA
AATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAG
AACCTGGGGGGATGATGTTGGATCATTGATGACCATAAAAAAAAAAAACATCTGGGAGTC
CTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATA
CACTGCATGCTGGGATACTGGTTAGAGATGTTACATATAGTCCAATTTCAACAAGGAGTT
TACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAG
AGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCAT
AAGTCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGATGT
GTCAGGAAGACCCATCCAATGGGATTGATAGCTCAAGCAAGGGATGGGATAGAGGAGAAG
TGATCAAGGCAGATAGATGTAAATTAGGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCA
TTATTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTC
CTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGGAGTATTTTGAGAGTGTGAGTTCA
TCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATAATTTAGT
ATCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAAAGCATACGAAAAAATATGTT
CCATGAACCGATTCCTATGAAGAGAGTGCAATGAAAGAGGTAGTGAACACTGCCAAAGAT
GCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAAT
CTAACCAGCACTACTAGTGATCAGCCGTTCAATAAATGCAGCACAATTTAGAGCCTGGGT
GGATGATGTTGGATCATTGATGATCAACAAAAAAAAAAACATCTGGGAGTCCTCTGAGAC
ATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTGCATG
CTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACATGTAG
ATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGCCAAT
CATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGG
AAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAG
AGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAGG
GCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTT
CTGCCTTTTACTCCCAGGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCT
GAGGTTTGGGATTCCCGGTTTGTGTCNNNNNNNNNNNNCCAGNNNNNNNNNNNNNTATTT
TCTNCNNNNNNNNNNTNTTTCCTGCANGNNNNNNCTCTTCCCCTATGNNNNNATTATCTT
NNNNNNNNNNNNGTTNNNANNNNNNNATTANNNNNNGNANNNNNNNNNNNNNNGNNNCAC
TGNNNNNNNNNNNNTATNNNNAGTNNNNNANNNNNNNNNNNNNNNCNNNNNNNNNANNNN
NTCNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNTNNNNNNNNNNNNNATN
NNTNNNNNACTANNNNNNNNNNNNNNNNCAATNNNNNNNNNNNNNNNNNNANNNNNNNNN
NNNANNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACCTNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNN
NNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNTANNN
NNNNNNGAGATGATGTTGGATCATTGATGANCNNAAANAAAAAAAAAANNNNNCTGGGAG
TCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTA
TACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAG
TTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGT
AGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATNCCC
CATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGA
TGTGTCAGGAAAACCCATTCAATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAAGAG
AAGTTATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTG
TCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATAACTCCAAGGTGATCTCCAAGTTC
TTCCTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGCAGTATTTTGAGAGTGTGAGT
TCATCTATTTTCTTCAGATCGATTTTTGTCTTGCATGTATTCCCTCTTCCGACATAATTT
AGTATCTTATGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAATA
TGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGCCAA
AGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTGGTTAATGATAGTTTTAAATGG
AAATCAAACCAGCACTACTAGTGATCAGCCGTTCAATAAATGCAGCACAATTTAGAGCCT
GGGTGGATGATGTTGGATCATTGATGAACAAAAAAAAAAAAAACATCTGGGAGTCCTCTG
AGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTG
CATGCTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACAT
GTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGC
CAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAAGCC
ATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAG
GAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGAT
CAGGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTT
TTTTCTGCCTTTTACTCCCAGGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAG
TCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCT
ATTTTCTTCAGTTCGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGGTTA
TCTTGGGAGAGCAACTGTAGACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTT
CCATGAACTGATACCTATGAAGAGTGTGCAATGACAGAGGTAATGACCTTTGCCAAAGAT
GCTCTCGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATC
TAACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGG
GGATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGA
TGACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATC
CTGGTGAGAGATGTTAGGAACAGTGTACTTTGAGCATGGAGTTTTAATGTAGATAAAGAA
AAAATTGGAAATTGTGTTTACTAAGACATAATCCCATAGGAAGAGTGCTAATCAACTTGA
CCGGGTAGTGTCTGAGTCAGAAACGATGACAGAGGGATCACAATAAGCCATGGAAAGTCA
TTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCAATC
CAATTGGATTGATAGCTCAAGCAAGGTATTGGATAGAGGAGAAGTGATCAAGGCAGATAG
ATGTAAATTATGGATGAGTAAAGAGAAAGTTTATCTTTTTGTCATTTTTTTTCTACATTT
TACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTG
GGATTCCCGGTTTTTGTCCGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGA
ACGATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGC
AACTGTAGACAGTAGTTCAATAAGAAACGCATACGAAAAAAAATATGTTCAAACCGATTC
CTATGAAGAGTATGCAATGATACAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAA
AGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTAC
TAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGAT
CATTGATGACCAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACA
ACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGAGATACTGGTTAG
AGATATTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGG
AAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGGAG
GTCTGAGCCAGAAACGATGACAGAAGAATCCCCATAAGTCATGGAAAATCATTGTCTATA
CTCCTGGATGACGTCAGAATCATGGGTTTTGATGTGTCAGGAAGACCCATCCAATGGGAT
TGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATT
ATGGATGAGTAAAGAGAAAGTTTATCTTTTTGTCATTTTTTTTCTACATTTTACTCTCAG
AATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTTCCG
GTTTTTGTCCGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTT
TTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGA
CAGTAGTTCAATAAGGAACGCATACGAAAAAAAAATATGTTCAAAACGATTCCTATGAAG
AGTATGCAATGATACAGGTAGTTACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACT
CAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATC
AGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGATCATTGATG
ACCAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGG
GAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGGGATACTGGTTAGAGATGTT
AGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGGAAATCGT
GTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGGAGATCTGAG
CCAGAAACGACGACAGAGGAATCCCCATAAGTCATGGAAAATCATTGTCTATGTTCCTGT
TGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGACCCATCCAATGGGATTGATAGC
TCAAGCAAGGGATTGGATAGAGGAGAAGTTATCAGGGCAGATAGCTGTAAATTATGGATG
ATTAAAGAGAAAGTTAATCTTTTTGACATATTTTTTCTGCCTTTTACTCCCAGAATACAT
ACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTG
TCAGTAGAATTGCGAGAGTGTGAGTTCATCCTATTTTCTTCAGTATGATTTTTTTTCTTG
CATGTAATGCCTCTTCCCCTATGAGTTGATAATCTTGGGAGAGCAACTGTAGACAGTGGT
TAATTAAGGAACCCATACGAAAAATATATGTTCCATGAACTGATCCGTATGAAGAGTGTG
GAATGACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACACAAGCA
TCTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCT
CAATAAATGCAGCCCAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATA
AAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCC
ACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTAC
TTTGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTTTACTAAGAC
ATAATCCCATAGAAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGAT
GACAGAGGGATCACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGTGACGTCAGAG
TCATGGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGT
ATTGGATAGAGGAGATGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAA
AGTTAATCTTTTTGTCATTTTTTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGT
GATCTCCAAGTTCTTCCTCTGTTGAGGTGTGGGATCCTGGTGTGTTTCAGCAGTATTTTG
AGAGTGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCCTCTT
CCGGCATAATTTAGTATCTTATGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCAT
ACGAAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAGGTAGT
GAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTT
AGTTTTCAATGGAAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCAC
AATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAGAAAAAAATCATCTCGGA
GTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCT
ATGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAAGGATTTCAACAA
GGAGTTTACATGTAGATTAATTAAAATTTGGAAATGGTGTCTACTGACACATAATCCCAT
AAGTAGAGTGCAAATCATTTTGACCGGAGAGATCTGAGCCAGAAATGACGACAGAGGAAT
CCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTT
TTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGA
GGAGAAGTGATCAAGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTT
TTTGTCATTTTTTTTCTGCCTTTTACTTCCAGGATACATACCTCCAAGGTGATTTCAGAG
TTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCCAGAGTGT
GAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTA
TGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTTAAATAAGGAACGCATACGAA
AAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATGACAGAGGTAATGACCT
TTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTT
TCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCACAGTTTA
GAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGA
AACATGCATGATGACCACAACATTGAGAGTCTGAGGTCCACATCATAATCTATGCACTGC
ATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTGTACTTTTAGCATGGAGTTTTAATG
TAGATTAAAGAAAAAATTGGAAATTGTGTTTACTAAGACATAATCCCATAGGAAGAGTGC
TAATCAACTTGACCGGGTAGTGTCTGAGTCAGAAACGATGACAGAGGGATCACAATAAGC
CATGGAAAGTCATTGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAG
GAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGTATTGGATAGAGGAGAAGTGAT
CAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTT
TTTTCTACATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAG
TCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCT
ATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTA
TCTTGGGAGAGCAGCTGTAGACAGTAGTTCAATAAGGAACGCATACGAAAAAAAATATGT
TCAAACCGAATCCTTGTAGAGTATGCAATGACAGAGGTGGTGACCACTGCCAAAGATGCT
CTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTA
ACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGGACCTGGGGGGA
TGATGTTGGATCATTGATGACCAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCC
ATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGG
ATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAA
TTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTT
TGACCGGGGAGATATGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAAT
CATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAAACCCA
TCCAATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAGGAGAAGTTATCAAGGCAGAT
AGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTGTCATTTTTTTTCTGCAT
TTTACTCTCAGAATAGATAACTCCAAGGTGATCTCCAAGTTTTTCCTCAGTCTTGAGGTG
TGGGATCCCGGTGTGTGTCAGCAGTAATTTGAGAGTGTGAGTTCATCTATTTTCTTCAGA
TCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATAATTTAGTATCTTGGGAGAGCAA
CTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAATATGTTCCATGAACCGATTC
CTATGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAA
AGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTATTTGGAAATCAAACCAGCACTAC
TAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGAT
CATTGATGACCAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACA
ACATTGGGGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGA
GAGATGTTAGAAATAGAATAATTTGAATAAGGAGTATACATGTAGATTAATTAAAATTGG
GAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGCCAATCATTTTGACCGGGGA
GAACTTAGCCAGAAACATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATG
TTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGA
TTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAAT
TATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCA
GGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCC
GGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTT
TTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAG
ACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTATGA
AGAGTGTGCAATGACAGAGGTAATGAACTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCA
CTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTT
CAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGA
TGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTC
TGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAA
CAGTGTACTTTGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTTT
ACTAAGACATAATCCCATAGGAAGAGTGCTAATCAACTTGACCGCGTAGTGTCTGAGTCA
GAAACAATGACAGAGGGATCACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGATGA
CGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCA
AGCAAGGTATTGGATAGAGGAGAAGTGATCAAGGTAGATAGATGTAAATTATGGATGAGT
AAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCTGCACTTTACTCTCAGAATAGATACCT
CCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAG
TAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATG
TATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTAGTTCAA
TAAGAAACGCATACGAAAAAAAATATGTTCAAACCGATTCCTATGAAGAGTATGCAATGA
TACAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGT
AGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATA
AATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAA
AAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTC
CACATCATAATCTATACACTGCATGCTGAGATACTGGTTAGAGATATTAGATATAGTCCA
ATTTCAACAAGGAGTTTNANNGNNANNNNNNNANNNNNGAGTTGGGGGAANNCNNGGNCT
ACTGNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNNGNNN
NNNNNNNNNCCAGNANNCNNNGGANAGAAANNNNNNCCCNNNNNNNNNNNNNNNNNTNNN
NNGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGATTAAAGCGTAAACGGAAGTCTATTAGAAACACGCATAATTGTCGGCTCTTAGGG
GGTGGAGTTCTTGATAGAAATGCAGGCCGCTGTGGCTTCTGGCTTTTTTGGCCCAGTGGC
GCCTGCATCTGGATTGTAGGAGGTCTGTGTGAGGAAGTAGAGGTTGTTACCTGGGACATC
ACAGTATGAAACAAAAGTTGTCAGTCGTTTTGTTTTAATGCTGCGTTCCCCTATTCTGTA
GCACTGAAACCTGCTTTACCTCCGGGACATGTAAAACAGACACACAGCCACACAAACGTA
GGACATTTTGGGGGTGGTAGGAGGTTGTACTAAGAAGAGAGGACAAATTACATGAATGAA
CAATTTTATGAGTATGTAGTGGAATAGGACAAGTGTGAGACAACGGAGAGCGTGTTGTCT
ATAATGCCAGACATCCCTTTCCTCTCATGTGGAATCTAAGCGGAATGGAAAAACAGAAAG
GACCAGCAGAGGTGTGTGCAAGGCAAGAGCAGGGATGAACCGGGGTAATGGGGGCAGACT
ATTGTTCGAATACTTAACAAACATGCATGAAACAGTTCCGTGAACCTTTTCTACATTTTA
CTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGANGNTTGGG
ATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAAC
GATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTCGGGGAGAGCA
ACTGTAGACAGTAGTTCAATAAGAAACGCATACGAAAAAAAATATGTTCAAACCGATTCC
TATGAAGAGTATGCAATGATACAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAA
GTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACT
AGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGGGATGATGTTGGATC
ATTGATGACCAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACA
ACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGAGATACTGGTTAG
AGATATTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAATATTTGG
AAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGGGAG
GTCTGAGCCAGAAACGATGACAGAAGAATCCCCATAAGTCATGGAAAATCATTGTCTATA
CTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCCATCCAATGGGAT
TGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATT
ATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTTCTGCATTTTACTCTCA
GAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTGTGGGATCCCG
GTGTGTGTCAGGAGTATTTTGGGAGTGTGAGTTCATCTATTTTCTTCAGATCGATTTTTT
TCTTGCATGTATTCCCTCTTCCGGCATAATTTAGTATCTTGGGAGAGCAACTGTAGACAG
TGGTTCAATAAGGAAAGCATACGAAAAAATATGTTCCATGAACCGATTCCTATGAAGAGT
ATGCAATGACAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAA
GCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGC
CGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGAAC
AAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTC
TGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGAAA
TAGACTAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGTCCA
CTGACACATAATCCCGTAAGAAGAGTGCCAATCATTTTGACCGGGGACAACTTAGCCAGA
AACGATGACAGAGGAATCCCCATAACACATGGAAAATCATTGTCTATGTTCCTGTTGACG
TCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAA
GCAAGGGATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAATTATGGATGAGTA
AAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCAGAATACATACCT
ACAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAG
TAGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATTTTTTTTCCTGCATG
TAATGCCTCTTCCCCTATGAGTTGATTATCTTGGGAGAGCAACTGTAGACAGTGGTTAAA
TAAGGAACGCATACGAAAAATATATGTTCCATGAAATGATCCCTATGAAGAGTGTGGAAT
GACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTG
GTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAAT
AAATGCAGCACAGTTTAGAGCCTGGGGGGGATGATGTTAGATCATTGATGACCATAAAAG
ATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCATAT
CATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTTG
AACATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAA
ACCAATATGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACA
GAGGAATCCCCATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGGGACGTCAGAGTCAT
GGGTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTG
GATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTT
AATCTTTCTGTCATTTTTTTTCTGCATTTTATTCTCAGAATAGATACCTCCAAGGTGATC
TCGAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGA
GAGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTT
CCGGTATGAATTTAGTATCTTGGGAGAGCAGCTGTAGACAGTAGTTCAATAAGGAACGCA
TACGAAAAAAAATATGTTCAAACCGAATCCTTGTAGAGTATGCAATGACAGAGGTGGTGA
CCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAGGCATCTGGTAGTTAATGTTAG
TTTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAA
TTTAGGACCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAACATCTGG
GAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAAT
CTACACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAG
GAGTTTACATGTAGATTAATTAATATTTGGAAATCGTGTCTACTGACACATAATCCCATA
AGTAGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATC
CCCATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTT
GATCTGTCAAGGAAAACCCATCCAATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAG
GAGAAGTTATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTAT
TTGTCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATAACTCCAAGGTGATCTCCAAG
TTCTTCCTCAGTCTTGAGGTGTGGGATCCCGGTGTGTGTCAGCAGTAATTTGAGAGTGTG
AGTTCATCTATTTTCTTCAGATCGATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATAA
TTTAGTCTTGGGAGAGCAACTGTAGACAGTGGTTCAATAAGGAACGCATACGAAAAAAAT
ATGTTCCATGAACCGATTCCTATGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGCCA
AAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTATTTG
GAAATCAAACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCC
TGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAAAAAAAATCTGGGAGTCCTCTGA
GACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTGC
ATGCTGGGATCCTGGTGAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACATG
TAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCATAAGAAGAGTGCC
AATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAACACA
TGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGG
AAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATC
AGGGCAGATAGCTGTAAATTATGGATGATTAAAGAGAAAGTTAATCTTTTTGACATTTTT
TTTTCTGCCTTTTACTCCCAGAATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAG
TCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCGAGAGTGTGAGTTCATCCT
ATTTTCTTCAGTATGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATAA
TCTTGGGAGAGAAACTGTAGACAGTGGTTAATTAAGGAACCCATACGAAAAATATATGTT
CCATGAACTGATCCCTATGAAGAGTGTGGAATGACAGAGGTAATGATCTTTGCCAAAGAT
GCTCTAGAGTTTAAAGTCCACACAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATC
TAACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCACCGTTTAGATCCTGGGGG
GGATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGA
TGACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATC
CTGGTGAGAGATGGTAGGAACAGTCTACTTTGAACATGGAGTTTTAATGTAGATTAAAGA
AAAAATTGGAAATTGTGTCTACTAAGACATAAACCCATAGGAAGAGTGCTAATCATCTTG
ACCGGGTAGTATCTGAGTCAGAAACGATGACAGAGGGATCCCCATAAGCCATGGAAAGTC
ATTGTCTACGTTCCTGGTGCCGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGAGCCAAT
CCAATTGGATTTATAGCTCAAGCAAGGGATTGGAAGGAGGAGAAGTGATCAAGGCAGATA
GATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTCTGTCATTTTTTTTCTGCATT
TTATTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTT
GGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAG
AACGATTTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATCTTGGGAGA
GCAGCTGTAGACAGTAGTTCAATAAGGAACGCATACGAAAAAAAATATGTTCAAACTGAA
TCCTTGTAGAGTATGCAATGACAGAGGTGGTGACCACTGCCAAAGATGCTCTAGAGTTTA
AAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTA
CTAGTGATCAGCGGCTCAATAAATGCAGCACAATTTAGAACCTGGGGAGATGATGTTGGA
TCATTGATGACCAAAAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGAT
GACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCATGCTGGGATAC
TGGTTAGAGATGTTAGATATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAA
TATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTTGAC
CGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATT
GTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAAACCCATTCA
ATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAAGAGAAGTTATCAAGGCAGATAGAT
GTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTGTCATTTTTTTTTCTGCATTTT
ACTCTCAGAATAGATAACTCCAAGGTGATCTCCAAGTTNTTCCTCAGTCTTGANNNNNGG
GATCCCGGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAT
CTGAGCCAGAAATGNNNACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTT
CCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGAAGAGNCCAATNNCCAAGTGG
ATTGATAGCTCAAGNCAAGGGATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAA
ATTATGGATGATTAAAGAGAAAGTTAATCTTTTTGACATTTTTTTTCTGCCTTTTACTCC
CAGGATACATACCTCCAAGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTC
CCGGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTTCGATT
TTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGGTTATCTTGGGAGAGCAACTGT
AGACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTAT
GAAGAGTGTGCAATGACAGAGGTAATGACCTTTGCCAAAGATGCTCTCGAGTTTAAAGTC
CACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTG
TTCAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATT
GATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAG
TCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGG
AACAGTCTACTTTGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGT
CTACTAAGACATAATCCCATAGGAAGAGTGCTAATCATCTTGATTGGGTAGTATCTGAGT
CAGAAACGATGACAGAGGGATCACAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGT
GAGGTCAGAGTCATGGGCTTTGATGTGTCAGGAAGAGCTAATCCAATTGGATTGATAGTT
CAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGA
GTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCTGCATTTTACTCTCAGAATAGATAC
CTCCAAGGTGATCTCCAAGTTCTTCCTCAGTATTGAGTTTTGGGATTCCGGTTTGTGTCA
GTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTTTTCAGAACGATTTTTTTCTTGCATG
TATTCCCTCTACCGGTATGAATTTAGTATCTTGGGAGAGCATCTGTAGACAGTGGTTCAA
TAAGGAACGCCTAAGAAAATAATATGTTCCATGAACCGATTTCTATGAAGAGTGTGCAAT
GACAGAGGTAGTGACCACTGCCAAAGGTACTCTAGAGTTTAAAGTCCACTCAAGCATCTG
GTAGTTAATGTTAGTTTCCAATGGAAATCTTACCAGCAGTACTAGTGATCAGCTGCTCAA
TAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAA
AAAAAAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGT
CTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGAA
ATAGTCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGTGTCT
ACTGACACATAATCCCATAAGTAGAGTGCTAATAATTTTGACCGGAGAGATCTGAGCCAG
AAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGAC
GTCAGAGTCATGGGTGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCA
AGCAAGGGATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAATTATGGATGAGT
AAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCAGAATACATACC
TCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCA
GTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCAT
GTATTCCCTCTTCCGATATGAATTTAGTATCTTGGGAGAGCAACTGTAGACAGTAGTTCA
ATAAGGAACGCATATGAAAAAAAATATGTTCAAACCGATTCCTATGAAGAGTATGCAATG
ACAGAGGTAGTGACCACTGCCAAAGATGCTCTAGAGTTTAAAGTCCAGTCAAGCATTTGG
TCGTTAATGTTAGTTTTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCTGTTCAAT
AAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAA
AAAAAAAATCTGGGAGTCCTCTGAAAATTCCATGATGACCACAACATTGGGAGTCTGAGG
TCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGACGTTAGAAATAGAC
TAATTTGAATAAGGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGTCCACTGAC
ACATAATCCCATAGGAAGAGTGCCAATCATTTTGACTGGGGATAACTTAGCCAGAAACGA
TGACAGAGGAATCCCCATAACACATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGA
GTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAG
GGATTGGATAGAGGAGAAGTGATCAGGGCAGATAGCTGTAAATTATGGATGAGTAAAGAG
AAAGTTAATCTTTTTGACATTTTTTTTCTGCCTTTTACTCCCAGAATACATACCTCCAAG
GTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAA
TTGCGAGAGTGTGAGGTCATCCTATTTTCTTCAGTATGATTTTTTTTCTTGCATGTAATG
CCTCTTCCCCTATGAGTTGATAATCTTGGGAGAGCAACTGTAGACAGTGGTTAATTAAGG
AACGCATACGAAAAATATATGTTCCATGAATTGATCCCTATGAAGAGTGTGGAATGACAC
AGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGT
TAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTATTCAGCTTCTCAATAAATG
CAGCACAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGATGTG
GGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATCATAA
TCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTTGAACAT
GGAGTTTACATGTAGATTAATTAAAATTGGGAAATCGTGTCCACTGACACATAATCCCAT
AAGAAGAGTGCCAATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAAT
CCCCATAACACATGGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTT
TTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGA
GGAGAAGTGATCGAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTT
TTTGTCATTTTTTTCTGCACTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGT
TCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTGTGTCATAGAATTGTGAGAGTGTGA
GTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCGTCTACCGGTATGA
ATTTAGTATCTTGGGAGAGCAACTATAGACAGTGGTTCAATAAGGAACGCCTATGAAAAT
AGTATGTTCCATGAACCTATTTCTATGAAGAGTATGCAATGACAGAGGTAGTGACCACTG
CCAAAGGTGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCA
ATGGAAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGA
GCCTGGGTGGATGATGTTGNNNNNNNNNNNNNNNNNNNANNNNNNNNTGGNNNNCCTCTG
GAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNN
NNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTTTGCNNNAGATGCTCTAGAGTTNNNNNTCCNCTCAAGCNATCTGGT
AGTTAATNNTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAATAA
ATGCAGCCCAGTTTAGAGCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGAT
GTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATCA
TAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTTGAA
CATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAAAC
CCATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACAGA
GGAATCCCCATAAGCCATGGAAAGTCATTGTCTACATTCCTGGTGCCGACAGAGTCATGG
GTTTTGATGTGTCAGGAAGAGCCAATCCAATTGGATTGATAGTTCAAGCAAGGGATTGGA
TAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAA
TCTTTTTGTCATTTTTTTCTGCACTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCC
AAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGTGAGAT
TGTGAGTTCATCCTATTTTCTTCAGAACGATTTTTTTCTTGCATGTATTCCGTCTACCGG
TATGAATTTAGTATCTTGGGAGAGCAACTATAGACAGTGGTTCAATAAGGAACGCCTATG
AAAATAGTATGTTCCATGAACCTATTTCTATGAAGAGTATGCAATGACAGAGGTAGTGAC
CACTGCCAAAGGTGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGT
TTTCAATGGAAATCTGACCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAAT
TTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAGAAAAAAATCATCTGGGAGTC
CTCTGAGACATCCATGATGACAAAAACATTGGGAGTCTGAGGTCCACATCATAATCTATG
CACTGCATGCTGGGATACTGGTTAGAGATGTTAGATATAGTCCAAGGATTTCAACAAGGA
GTTTACATTTAGATTAATTAAAATTTGGAAATCGTGTCTACTGACACATAATCCCATAAG
TAGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGGGAATCCCC
ATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATAGGTTTTGAT
ATGTCAGGANNNCCNANNNNNNTNNGNNNGATAGCTCANGCAAGGGATCGGATAGAGGAG
AAGTGATCAGGGCAGATAGCTGTAAATTATGGATGAGTAAAGAGNNNGTTAATCTNTTTG
TCATTTTTTTTCTGCCTTTTACTCCCAGAATACATACCTCCAAGGTGATTTCAGAGTTCT
TCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCGAGAGTGTGAGT
TCATCCTATTTTCTTCAGTATGATTTTTTTCCTTGCATGTAATGCCTCTTCCCCTATGAG
TTGATAATCTTGGGAGAGAAACTGTAGACAGTGGTTAATTAAGGAACGCATACGAAAAAT
ATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATGACAGAGGTAATGACCTTTGC
CAAAAATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAA
TGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCCCAGTTTAGAGC
CTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACA
TGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGC
TGGGATCCTGGTGAGAGATGTTAGGAACAGTCTACTTTGAACATGGAGTTTTAATGTAGA
TTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAAACCCATAGGAAGAGTGCTAAT
CATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACAGAGGAATCCCCATAAGCCATG
GAAAGTCATTGTCTACATTCCTGGTGCCGTCAGAGTCATGGGTTTTGATGTGTCAGGAAG
AGCCAATCCAATTGGATTGATAGTTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAG
GCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTCTGACATTTTTTTT
CTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTC
TTGAGGTTTGGCATTCCCGGTTTTTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTAT
TTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGAATTTAGTATC
TTGGGAGAGCAACTGTAGACAGTAGTTCAATAAGGAACGCATATGAAAAAAAATATGTTC
AAACCGATTCCTATGAAGAGTATGCAATGACAGAGGTAGTGACCACTGCCAAAGATGCTC
TAGAGTTTAAAGTCCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCTAA
CCAGCACTACTAGTGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGAT
GATGTTGGATCATTGATGACCAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCAT
GATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATACACTGCTTGCTGGGA
TACTGGTTAGAGATGTTAGATATAGTCCAATTTCATCAAGGAGTTTACATGTAGATTAAT
TAATATTTGGAAATCGTGTCTACTGACACATAATCCCATAAGTAGAGTGCAAATCATTTG
ACCGGGGAGGTCTGAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCGTGGAAATCAT
TGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAGACCCATCC
AATGGGATTGATAGCTCAAGCAAGGGATCGGATAGAGGAGAAGTGATCAAGGCAGATAGA
TGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTATTTGTCATTTTTTTTTCTGCATTT
TACTATCAGAATAGATACCTCCAAGGTGAACTCCAAGTTCTTCCTCAGTCTTTAGGTGTG
GGATCCCGGTGTGTGTCAAGAGTATTTTGAGAGTGTGAGTTCATCTATTTTCTTCAGATC
GATTTTTTTCTTGCATGTATTCCCTCTTCCGGCATAATTTAGTATCTTGGGAGAGCAACT
GTAGACAGTGGTTCAATAAGGAAAGCATACGAAAAAATATGTTCCATGAACCGATTCCTA
TGAAGAGAGTGCAATGACAGAGGTAGTGAACACTGCCAAAGATGCTCTAGAGTTTAAAGT
CCAGTCAAGCATTTGGTAGTTAATGTTAGTTTTAAATGGAAATCTGACCAGCACTACTAG
TGATCAGCTGTTCAATAAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCAC
TGATGACAAAAAAAAAAAAAAAAAAACATCTGGGAGTCCTCTGAGACATCCATGATGACC
ACAACATTGGGAGTCTGAGGTCCACATCATAGTCTATGCATTGCATGCTGGTATCCTGGT
GAGAGATGTTAGAAATAGACTAATTAGGATAAGGAGTTTACATGTAGATTAATTAAAATT
TGGAAATCGTGTCTACTGACACATAATCCCATAAGAAGAGTGCCAATCATTTTGACCGGG
GAGAACTTAGCCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCT
ATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAAGAAGAGCCAATCCAATTG
GATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGCTGTAA
ATTATGGATAGGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCT
CAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGACTTGAGGTTTGGGATTC
CCGGTGGTGTCAGCACAATTGCCAGAGTGTGAGTTCATCCTATTTTCTTCAGTATGATTT
TTTTTCTTGCATGTAATGCCTCTTCCCGTATGAGTTGATAATCTTGGGAGAGCAACTGTA
GACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTATG
AAGAGTGTGCAATGACAGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCC
ACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGT
TCAGCTTCTCAATAAATGCAGCACAGATTAGATCCTGGGGGGGATGATGTTGGATCATTG
ATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGT
CTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAAATGTTAGGA
ACAGTCTACTTTGAGCATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTC
TACTAAGACATAATCCCATAGGAAGAGTGCTAATCATCTTGATCGGGTAGTATCTGAGTC
AGAAACGATGACAGAGGGATCCCAATAAGCCATGGAAAGTCATTGTCTATGTTCCTGGTG
ACGTCAGAGTCATGGGCTTTGATCTGTCAGGAAGAGCCAATCCAATTGGATTGATAGTTC
AAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAG
TAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCATTTTACTCTCAGAATAGATAC
CTCCAAGGTGATCTCCAAGTTCTTCCTCAGTATTGAGTTTTGGGATTCCGGTTTGTGTCA
GTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTTTTCGGAACGATTTTTTTCTTGCATG
TATTCCCTCTACCGGTATGAATTTAGTATCTTGGGAGAGCATCTGTAGACAGTGGTTCAA
TAAGGAACGCCTAAGAAAATAATATGTTCCATGAACCGATTTCTATGAAGAGTATGCAAT
GACAGAGGTAGTGACCACTGCCAAAGGTGCTCTAGAGTTTAAAACCACTCAAGCATCTGG
TAGTTAATGTTAGTTTTCAATGGAAATCTAACCAGCAGTACTAGTGATCAGCTGCTCAAT
AAATGCAGCACAATTTAGAGCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAA
AAAAAAATCATCTGGGAGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGA
GGTCCACATCATAATCTATGCACTGCATGCTGGGATACTGGTTAGAGATGTTAGAAATAG
TCCAATTTCAACAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGTGTCTATTG
ACACATAATCCCATAAGTAGAGTGCAAATCATTTTGACCGGAGAGATCTGAGCCAGAAAC
GATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGTCTATGTTCCTGTTGACGTCA
GAGTCATGGTGGTTTTATGGGTCAGGAAGAGCCAATCCAAGTGGATTGATAGCTCAAGCA
AGGGATTGGATAGAGGAGAAGTGATCTGGGCAGATAGCTGTTAATTATGGATGAGTAAAG
AGAAAGTTAATCTTTTTGTCATTTTTTTTCTGCCTTTTACTCCCAGAATACATACCTCCA
AGGTGATTTCAGAGTTCTTCCTCAGTCCTGAGGTTTGGGATTCCCGGTTTGTGTCAGTAG
AATTGCGAGAGTGTGAGTTCATCCTATTTTCTTCAGTATGATTTTTTTTCTTGCATGTAA
TGCCTCTTCCCCTATGAGTTGATAATCTTGGGAGAGAGACTGTAGACAGTGGTTAATTAA
GGAACGCATACGAAAAATATATGTTCCATGAACTGATACCTATGAAGAGTGTGCAATGAC
AGAGGTAATGACCTTTGCCAAAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTA
GTTAATGTTAGTTTTCAATGGAATCTAACCAGCACTACTAGTGTTCAGCTTCTCAATAAA
TGCAGCACAGATTAGATCCTGGGGGGGATGATGTTGGATCATTGATGACCATAAAAGATG
TGGGAGTCGTCTGAAACATGCATGATGACCACAACATTGCGAGTCTGAGGTCCACATCAT
AATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGGTAGGAACAGTCTACTTTGAAC
ATGGAGTTTTAATGTAGATTAAAGAAAAAATTGGAAATTGTGTCTACTAAGACATAAACC
CATAGGAAGAGTGCTAATCATCTTGACCGGGTAGTATCTGAGTCAGAAACGATGACAGAG
GAATCCCCATAAGCCATGGAAAGTCATTGTCTACGTTCCTGGTGCCGTCAGAGTCATGGG
TTTTGATGTGCCAGGAAGAGCCAATCCAATTGGATTGATAGCTCAAGCAAGGGATTGGAT
AGAGGAGAAGTGATCAAGGCAGATAGATGAAAATTATGGATGAGTAAAGAGAAAGTTAAT
CTTTCTGTCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTC
CAAGTTCTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTTTGTCAGTAGAATTGTGAGA
GTGTGAGTTCATCCTATTTTCTCAAGAACGATTTTTTTTCTTGCATGTATTCCCTCTTCC
GGTATGAATTTAGTATCTTGGGAGAGCAGCTGTAGACAGTAGTTCAATAAGGAACGCATA
CGAAAAAAAATATGTTCAAACCAAATCCTTGTAGAGTATGCAATGACAGAGGTAGTGACC
ACTGCCATAGATGCTCTAGAGTTTAAAGTCCACTCAAGCATCTGGTAGTTAATGTTAGTT
TTAAATGGAAATCTAACCAGCACTACTAGTGATCAGCGGCTCAATAAATGCAGCACAATT
TAGAACCTGGGGGGATGATGTTGGATCATTGATGACCAAAAAAAAAATAAAACATCTGGG
AGTCCTCTGAGACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATC
TATACACTGCATGCTGGGATACTGGTTAGAGATGTTAGATGTAGTCCAATTTCAACAAGG
AGTTTACATGTAGATTAATTAATATTTAGAAATCGTGTCTACTGACACATAATCCCATAT
GTAGAGTGCAAATCATTTTGACCGGGGAGATCTGAGCCAGAAACGATGACAGAGGAATCC
CCATAAGCCATGGAAAATCATTGTCTATATTCCTGGATGACGTCAGAGTCATGGGTTTTG
ATGTGTCATGAAGAGCCATCCAATTGGATTGATAGCTCAAGCAAGGGATCGGATAGAGGA
GAAGTGATCAAGGCAGATAGATGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTCTTT
GTCATTTTTTTTTCTGCATTTTACTCTCAGAATAGATACCTCCAAGGTGATCTCCACGTT
CTTCCTCAGTCTTGAGGTTTGGGATTCCCGGTTTGTGTCAGCACAATTGTGAGAGTGTGA
GTTCATCCTATTTTCTTGAGAACGATTTTTTTCTTGCATGTATTCCCTCTTCCGGTATGA
ATTTAGTATCCTGGGAGAGCATCTGTAGACAGTGGTTCAATAAGGAACGCCTAAGAAAGT
AATATGTTCCATGAACCGATTTCTATGAAGAGTGTGCAATGAAAGAGGTAGTGATCACTG
CCAAAGATGCTCTAGATTTTAAAGTCCACTCAAGCATCTGGTACTTAATGTTAGTTTTCA
ATGGAAATCTAACCAGCAGTACTAGTGATCAGCTGCTCAATCAATACAGCACAATTTAGA
GCCTGGGTGGATGATGTTGGATCATTGATGACCAAAAAAAATCATCTGGGAGTCCTCTGA
GACATCCATGATGACCACAACATTGGGAGTCTGAGGTCCACATCATAATCTATGCACTGC
ATGCTGGGATCCTGGTTAGAGATGTTAGAAATAGACTAATTTGAATAAGGAGTTTACATG
TAGATTAATTAAAATTTGGAAATCGTGTCCACTGACACATAATCTCATAAGAAGAGTGCC
AATCATTTTGACCGGGGAGAACTTAGCCAGAAACGATGACAGAGGAATCCTATAAGCCAT
GGAAAATCATTGTCTATGTTCCTGTTGACGTCAGAGTCATGGTGGTTTTATGGGTCAGGA
AGAGCCAATCCAAGTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCA
GGGAGATAGCTGTAAATTATGGATGAGTAAGAGAAAGTTAATCTTTTTGTCATTTTTTTT
CTGCCTTTTACTCCCAGAATACATACCTCCACGGTGATTTCAGAGTTCTTCCTCAGTCCT
GAGGTTTGGGATTCCCGGTTTGTGTCAGTAGAATTGCCAGAGTGTGAGTTCATCCTATTT
TCTTCAGTTTGATTTTTTTTCTTGCATGTAATGCCTCTTCCCCTATGAGTTGATTATCTT
GGGAGAGCAACTGTAGACAGTGGTTAAATAAGGAACGCATACGAAAAATATATGTTCCAT
GAACTGATACCTATGAAGAGTGTGCAAGGACAGAGGTAGTGACCATTTCCAAAGATGCTC
TAGAGTTTAAAGTCCACTCAAGCATCTGGAAGTTAATATTAGTTTTCAATGGAAATCTAA
CCAGCACTACTAGTGTTCAGCTTCTCAATAAATGCAGCACAGTTTAGAGCCTGGGGGAGA
ATGATGTTGGATCATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATG
ACCACAACATTGCGAGTCTGAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCT
GGTGAGAGATGTTAGGAACAGTCTACTTTGAGCATGGAGTTTTAATGTAGATTAAAGAAA
AAATTGGAAATTGTGTCTACTAAGACATAATCCCATAGGAAGAGTGCTAATCATCTTGAC
CGGGTAGTATCTGAGTCAGAAACGATGACAGAGGAATCCCCATAAGCCATGGAAAGTCAT
TGTCTATGTTCCTGGTGACGTCAGAGTCATGGGTTTTGATGTGTCAGGAAAAGCCAATCC
AATTGGATTGATAGCTCAAGCAAGGGATTGGATAGAGGAGAAGTGATCAAGGCAGATAGA
TGTAAATTATGGATGAGTAAAGAGAAAGTTAATCTTTTTGTCATTTTTTTCTGCACTTTA
CTCTCAGAATAGATACCTCCAAGGTGATCTCCAAGTTCTTCCTCAGTCTTGAGGTTTGGG
ATTCCCGGTTTGTGTCAGTAGAATTGTGAGAGTGTGAGTTCATCCTATTTTCTTCAGAAC
GATTTTTTTCTTGCATGTAATGCCTCGTCTCCCATTAGTTTAGTATCTTGGGAGAGCAAC
TGGAGACAGTAGCTCAATAAGGAACGCATACAAAAAAAATATGTTCCGTGAACCAATTCC
TATGAAGACTGTGCAATGACAGAGGTAGTGACCACTGTCCAAGATGCTCTAGAGTTTAAA
GTCCACTCAAGCATCTGGTAGTTAATGTTAGTTTTCAATGGAAATCTAACCAGCACTACT
AGTGATCAGCTGCTGAATAAATGGAGCACAATTTAGAGCCTGGGGGGATGATATTGGATC
ATTGATGACCATAAAAGATGTGGGAGTCGTCTGAAACATGCATGATGACCACAACACTGC
GAGTTTTAGGTCCACATCATAATCTATGCACTGCATGCTGGGATCCTGGTGAGAGATGTT
AGAAATAGACTACTTTGAACAAGGAGTTTACATGTAGATTAATTAAAATTTGGAAATCGT
GTCTAATAAGACATAATCCCGTAGGAAGCTTGCTAATCATCTTGACCAGGTAGTATCTGA
AATCCGAAATGATGACAGAGGAATCCCCATAAGCCATGGAAAATCATTGGCTATGTTCCT
GGTGACGTCAGAGTCATGGGGGATTGATGTGTCAGGAAGGGCCAATCCAAGTGGATTGAT
AGCTCAAGCAAGGGATTGGACGGAGGAGTAGTGATCAAGGCAGATAGCTGTAAATTATGT
ATTAGTAAATAGAAAGTTAATCTTTTTGTCATTTTTTTTCTACATTTTACTCTCTGAAAA
GATACCTCCAAGGTGACTTCCAAGTTCTTCCTCAGTCCAGAGGTTTTGGTTTCTCAGTTT
GAGTAAGCAGAATGGGAGAGTGTGAGTTCATCCTATATTCTTCTGTATGGTTGTGGATGA
CTTAAGGATCTTGTTCCTAACCCTTTTTGACTCCTAGTCCCCTACATGTTATTAGGGAAA
TGGCAGGGTAATTAATCAATACGTGTAGAAATGTATTGTAGTTGACCTATTTTGTATCAA
TAGTGACCACCATGTTTACAGTTCTGTATGTCTGAAGTCTACCCTGTATTTTAACAGTGG
TCCTCCTCACAGATGTGAGAATAGAGGCAGCATTGTATCCTTGTAGATAGTATTAATGGA
TACACATGTATAAAAATATAAATAAGAATTGTTCTGGGTTGGGGATTTAGCTCAGTTGTA
GAGCACTTGCCTAGCAAGTGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAAAAGAAA
AAAGAGAAGAAGAAAAAAAAAGAATTGTGGTGATATTCAAATTATAGAATAAGGATGAAT
GTAATTTTGCTATACAGTAGACATATTTGTTTTGTTTTGTTTTTTTTTATCAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved