Rattus_norvegicus Locus Mono:486:SNORA77
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:486:SNORA77
Rattus_norvegicus
Mono:486:SNORA77
14
SNORA77
1001..1129
2129
GAGGATGCTGTCTGCTCCTGGCTTCAATTGGGTGAAGATGTAGAACTCAGCTCCTCCTG
CACCATGCCTGCCTGGATGCTGCCTTCCCGTCTTGATGATAATGGACTGAACCTCTGAAC
CTGTAAGCCAGCCCCAATTAAATGTTGTCCTTTATAAAACTTACATTGGTCGTGATGTCT
GCTCACTGAAATAAGACCCTAACTAAACTGAAGCAATTCTGCCCCATGGAGACATCTGTT
GATACTAGAGTCACTGTTTATCACAGAGTGGGAGGCAGAGGCTTTATAACATCTAGAATA
CACCATGTAACACAACACCCATCTAGCCCAAAATGTCAGGAACACTCTTGCTGAATTGCA
TCAGGAGAGGAGACTTACAGAAAAAGCTACACTATTATCAGCTACACACTCTAACTAACC
CACATACAACAAAGAGTAAAAGGACATCAGACATTGCAGGGTCAAGAGGCTTATTAGAGC
CTGCACGTCCCTGAACGCCTTGGCCTCCAGGGTGGTACTACTGAAAGGGGGTGGAAGCTT
CGGAGGTAGAGCCCAGTGGAAGGCCCTAAAGGGAGAAGAGGACCCAATCTCTCCTTCTGC
TTTTCTGTCTCTTGGTCATGAGGACCATTCCACTTTACCACATGCTCCCACCATGATGTG
TTCCTTCGTCAGAGTCCCACAGCAATGAGGCAACAGGTCACAGATTAGAAACCTCCAAAA
CTCAGAGCCAAAATAACCTTTCTCTTTCTAAGTAGATTATCTCAAGGTATTTTGTGAGAG
TAACAAAGCGGTGGACAATACATAGGACAGGTGCTTCCTAAAAATTCAAGATAAAAACAG
AAATAAGCTAAGCTGGCAGCCCATCACTAGCACGTGCATGCTGAAAATTTGAAAGCGGGC
CAAAAAGGTTAAATATATTTATAAACATCACATTTCTAACATACTCATATTTCCAAAATT
TATCAAGAAAGTAGACAAGAGAAAAAAATGATCACTTAGATGAGAATATCTATGTACTTG
TGTCCATTAAGATAGAATCTCAAGTGCTTTTTCCATCTGCCAAAGAAACAATCCGGGTGC
TGTGGCTGCCTCCACTTATCAGGGGCAATACAGCAGCCGGGGACACAGCCTAAAAAAGAA
AGAAAAAAGAAAAAAGAAAAAAGAAAAAAGAAAAAAGATGAAAAAAAAGATAGAATTTCA
AAAACATAAGAACAATCAATTAGTTTCAAAAACTAAGGCAAAGGAAGCATTACAATTTAC
ACACACAACAAAGAAGTCGATCTGCAAAGTAAACTAAAGGCAAGTACAGTAACGGTAAAG
AGCTGAAACGGACATCTAACCAAGTCATATCCTTCCTAGAGATTCTGCCCACACCTCCAG
CTTTCTCACATACTATTTAATAAAATAGCTACAAGGACTTAAAAGGTAAACATTTTGAAA
GGCTAAAGAACCAAACCAAGAGATCACCTGCTGAACATATAACAAGAAGCAAGAATTTCA
AGCCTGAGTTTGATCAAGATAACTACATGCTAAATCAAAAGAACCAACATTCTTGTGGGA
AAATAACAGAATCCAATACAATAAAACCAAAATAATGAAAATAAGAAAACGACTTGTATG
GTTACATCAAGACAATGAACCAGGGGCTGGAGAGATGGCTCAGGGGTTAAGAATACTGGC
TGGGGGTTGGGGATTTGGCTCAGTGGTAGAGCGCTTACCTAGGAAGCGCAAGGTCCTGGG
TTCAGTCCCCAGCCCCGGAAAAAAAAAAAAAAAGAATACTGGCTGTTCTTCCAGAGGTCC
TGAGTTCAATTCCCAGCAACCATGGTGGCTCACAACCATCTGTAATGCCCTCCTCTGGTG
TGTCTGAAGATAGATACTGTGTACTCATATATAAATAAAATGAATAAATCTTTTTAAAAA
AAAAAAAGACAATGAACCATAAAGGATCCAGATATCTGATCAAACATAACTCCTAAGTTT
GTGTGAGGTGAAATAAAGACGTCCCTCCCCAAAGTAGTTGAGCCTTATCTTAGCTGAAGT
CCTGAAAAGAAAAGCTGGCCCTCCTGGAATGAGAGAATTCTTCCTGCCTGACCTATAGCA
AGGACATCTGCTTTTTCCTGCCTTTCCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved