Rattus_norvegicus Locus Mono:543:SNORD60
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:543:SNORD60
Rattus_norvegicus
Mono:543:SNORD60
10
SNORD60
1001..1083
2083
GGAATCCGGTTCTCCGCCGACTCTCCAGAGCCTAGGATACTGCTTGGTACACAAGCAGC
GCTCAAAATCGTAGGAGTGCGGAGAGAACGAAAGAGAGAGTGAAGGGAAGGAGTGACAGA
CGGATCTACTGAGAGTCAGGATGACTTACAGAGGCTGAGACCCCAGCTGTCTCAGTCCCG
CCCCCCAGGCTAGGCCCACGACCGCTCGCGACGGTCCCATAACCAGCCCGCGCCCCACCG
CACTCCGCGGAAGACGGAGTCCCAGGTCCAGTGCGCGGCGCACTCACTCACCCGCCCGCA
GCTGCCTGGGAGCAGCGGCTACACCCTCCGGCATCATCTTGCCCCTCTCGGCCCGGGGCC
GGGAAAGGTACAGGATACAGGAGCCGGAAGTCCCCGGGCACTGTGCACGTCGGAACTTGT
AGTTCACCGACTTCAGGAACTCTAGGGGCTGCTTCACGCTTTGAGCTTCCTAAACTACGA
CTTCCGGCGCCCTCTGCACTGAAGAACCGGATTGGTAGCTTCAGAATCACTCTATGTTAC
AGATAGGAATTTGATTGGCTAACAGCCTTGTCACTCATGGACTCGGCTCTACCACCCGGA
GGCTATTCCAGCTACCCAAGATACCGCCTCCAAAACAAAATTGACGGTACGATTGGTGGA
AACTGCAGGATAGCTTGAGGAGCATATCAGCAGTGGAGGAAGGTGGGCACTTCCTCAGAG
ATGGACCAATCACGCAAGGGGCAGTTCTATAAACTCTTGAGCCTCGCGAGCAGTCATTCT
TTTTGGGGTTTAGCGTGTGTGCGTGCGTTCTTTCGTCCAGTTTTTATAAGGAACGTTTTA
TGAACTGTGGTCGCCAGGTGGAACTCAAAAGTCTCCTCGACTGCAGTTCGGCCTTCTTCG
AGAAGGACTAAGTCCTAAGGACTTAAACCTTTATCATTTATCTTCTGACTCCTTTTTTGC
AGGTAAGAATGAGGCGGGCCTGGCTTCCCTTTGCAGCCCCAAGCCTGTGATGAATTCAAT
TTCTGACACCTCGTATGAAAACTGCATACATGTGCAGTCTGATTACACTATAAAACTGAG
GCTGGGGGCGACGCCATTAATTGGATGGGTTTTGGGTGAAAAGTTTACTTAAGTGAAGAT
CTATGTTTGTTTGTTTTTTTTCCCCAGAAGCACATTGAGTCGGCTGCAGACCTTCACAGT
AAATAGGCTGCATCTCAAGACCCAACGGATAGGAGTGTTGGCTGGTAAGCGGGGCATCTG
TGTATCTAAGCTAGCAATAAAGCGGAAGTACAACCTCACTCTGGTCTCAAACGTTATTTC
GTGTGCTGTTAGGACAATACCGTAGAGGGCCTGGTCTTTTCACAGTCTGTAAAGGGGCTG
CTGAGTCACAAGAGTAAGTCCTTTCTGTCCGTATCCTTCTAGTCTAGGGTGAGCGTTTAA
GCTAGTACTGCCTCAGGTGGGACACCCTAATCTTGATAATCCTAATCCTAGTGGGGAGGA
TATCTGTGTATAAGTTGATGTTTCCCCAGGTGAGTTCTGGCTTGCAGGGAAGTACCTTTT
ACCCCCTCCCCCACAAAGCCATTCTGTTGGCCCCAGAAGGTGACTTTCCACAGATGACAC
AAACTCCAGAAACACCTTTATTAATGGGGACAGGTTTTCACACAACATTTGTAGTCTGGT
GACTTTAGTACAAGGTGGGAAGGACTGGGCCAGCCTGCTAAGTAGTGACCTGGTTCTATC
AGCCCAATCTTCCTGTGGTTTCCTACATCAGAGCCTACTAGTTGACTTGGAAGCAACCCA
ACAAATGGACAACATGATTCTTGTAGCCTTTGGTCGTGTGTGGGGTCCTTCCCAGGCCGT
GTGCAGTAAGCATGGCTTTTCATAGGAGGCACGATGTGGTGCCATCCTTCCTGCTGGGAG
TGCCCAGAAGAGGGCAGCCACAGGCCATAGTGTGGTTTGTATGCTTTCTGTGATGGCCCC
TGAGGCCAAGGGGCTGAAGAGCATCAGCCTCAGGTGTCTTGAAAAGGAAGACATTCTGGC
ATCCATCACCTATGGTATCCCAAACAGCTGCCTCCAGCGTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved