Rattus_norvegicus Locus Mono:91:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:91:SNORA44
Rattus_norvegicus
Mono:91:SNORA44
8
SNORA44
1001..1113
2113
ACAGGCTGTTATTCTGTCTGGGAGTTTTATCTGGTAAATTCCTTTTCAGATCTCTTCTC
AAATGTCCCTCCTCAAGGAAAATAATTCCTTTTCCTCCTCCCAGACTAGGTCAGAGGCTT
CTACTTACTGTTAGCTGCTTTCTCTTTTCATAGCATACCCTGAGTTGCCATAATATATTT
ATTGTGATTACCAGACTGGTCTATCTCTGCCAACTAAAGTGTAAATTCTATGAGGGTGGG
AATCCTTCTCATTTAGTTCACATATGTGTGTATATAAATATATATGCATACACATGTATA
TGCATATATATACACACATATAAATATGTATACACACATACAGTAGGAGTTCAATATATA
TCAGTATTTTTAAATACATGAAAAGTCAATTCAACACAACTTAGCAGTGGAAAATGAAGA
CAAACATTTAGCACATGCACATCTGAAATGTTAGTAGACTACAAGCAGAATTCTGAGTAT
CATAGTCTCATCACAATAAGCAAAAAGACTTTAGAACAACATACTTATATTTGGTAACTT
TTTAAAATTTATGTATTATGTATAGTGTTCTGCCTGTATACATGCCCACAGGCCAGAAAA
GAGCACCAGATCTCATTACAGATGGTTGCGAGCCACCATGTGGTTGCTGGGAATTGAACT
CAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGCTGTCTCTCCAGCCCCCTG
TGTTTTAGTAATTTTGAAAAGTTATAATGTAAAATATATTTGTAGTAGAGAACATTTAAC
TTCACTGTTTGAGAAAGAATTTCAATTTCTTCCTTCTGGACTGTCTAGAATTCATTTTGT
AACTTGTGCTGATCTCAAACTCGTCTATCCCTATTAAATGCTATAAGTGCTAGGATTATT
TGCAAAAGCACTACATTCAGCTTAATTTTACTCTTAATGTAGAATAAGACATAAAAATTC
ATTTTTTAAAGACAAGGTTGGGGAGCTAAACACTTTTAACTTTTAGAGTTAAAAGCACTG
GCTTCATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAGCCCAGGTTATCACA
GTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTATGAGCTGCCT
GTCCTTCTGTCCTGTGGTATTCAAAACAAACTTTCCTTCTGCAGTGTGCACTTGGGCGGT
TCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACCTAAGGACCATGTGA
CCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGAAAAATGCCACAAGA
AGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCCTTTTGTGGCC
AGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACCTTTGTAACCTAACA
TGCAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAAAAAAAAAAAAGCACTGG
CTTCCCTTCTAAAGGATCTGGGTTCAATCCCCAGCACCCACGTAGTAGCTCATAGCAGTC
TGTAATTCTAGTTGCAGGGGATCTAGTGTCCTCTTCTGGCCTCTGTGGGCAGAAGTATAA
ACATACAGAGGCAAAACAGCCATACACATTAGACAGATGGATGGGCAGGTGGGTGGACAG
ATGTACGGATGGACAAATGGACAGACATATATATATAGGCGGACAGACAAAAAAGTCACA
GAGCTAAGGACGAAGCTCAGTGGTAGTAGCATAATTGCCTTGCATGTACAAAGCCCAGTG
TTTCAGTCCCTGAACCACACACATATAAGATAAAAAGTGTCCCAAAATGGGATAATTTAA
GCCACAAAAAACATCAATCCTGGATTACAACCTAAACTATAAATCTATGTGTAAAAGTCC
ATAGTGGGGGAGGGCAGGGTGCGGAGGATGTTTACCTGGAAACCAGGAAAGGTAATAAAA
ATTGTAATGTAAATAAGAAATATCCAATTTAATAAAGATGGAGGGAAAAAAGTAAAAATA
AAAAAAATAAGTCCATCGTGATAAAAATAAATAATCTGAATAGGTGAAAAACAAGACAAT
CCTTTATGCCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved