Rattus_norvegicus Locus Mono:63:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:63:SNORA44
Rattus_norvegicus
Mono:63:SNORA44
8
SNORA44
1001..1116
2116
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTGCCCGGAAACCGGGAAAGGGAATAACACTCTGAA
ATGTATATAAGAAATACTCAAGTTAATAAAAAAAGAAAGACATATGGAATATTTCCAGCT
TCCAGGCTATTAAAAATAAGGCTGATATGAACATATTTGAGCATGTGTCCTTGTTATTTT
TTGGAACATCCTTTGGGTGTATGCCTAGGTGCAGCATAGCTGGGTTTTCAGGTAAAGCAA
CTTCCAAATCTGAGGAACTGTCATATTGATTTCCCAAACGGTTTTTACACGATTGTAATT
CCACCAGTAATAGAGGAGTCTTCCTCTTTCTCCACATCTGATATTGCCTGAGTTTTTTTT
TTCTTTTTTTTTTTTTTTTATCTTAGCCATTCTGATTGGTGTAAGGGGGAAATCTCAGGG
TCATCTTGATGTACATTTCTGTGATGACTAAAGATGTTGAACATTTCTTTAGGTGCTTCT
CGGCCATTTCAGATTCCTCAGCTAAGACCTCTTTTTTTTTTTTAGTTCTGTATACCAAAT
TTTAATTCGGCCATTTGTTTTTCTGGAATCTAACTTCTTGACTACTTTGTGTATTTTGGA
TATGAGCCTTCTATTAAATGTAGTGTTGATAAAGATCTTTTTCCAACATGTAGGTTGCTA
TTTTGTCCTACTGCCAGTCTCCTTTGCCTGACAGAAGCTTTTCAGTATTATGTGGTCTCA
TTTGTCAACTGCTGATCTTAGATGATGAGCCAATGGTGTTCTGTCCAGGAAATTTTCACC
TGTGCCTACATGATCAGGACTATTTCCGACATGCTCTTCATTTAGATTAAGCTTATATGG
TTTTATGTGAAGGTCCTTGATCCACTTGGACAAAAGCTTTGTAAAGGGAAATTAAAAATG
TTTTTAAAAGGCAGATCAGCATGCCAGAGTAACGGAGAGACTTTGACAGCCCAGGTTATC
ACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTATGAGCTG
CCTGTCCTTCTGTCCTGTGGTATTCAAAACAAACTTTCCTTCTGCAGTGTGCACTTGGGC
GGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACCTAAGGACCATG
TGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGAAAAATGCCACA
AGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCCTTTTGTG
GCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACCTTTGTAACCTA
ACATGCAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAAAAAAGGCAGATCAA
TATGAATTCTACTTACAGACCTCCAATTAAACCAGCACCATTTGTTGAAAATGCTGTTTC
TTTCAGCCCCCCAGAGGATTATTTTAGTTTCTTTGTCAAATATCAAGTAACCATAGGTTT
AGATCTGTATCTTCAATCCATTGATTGATCTACCTGTCTGTACAAATACGATTTGCTTTT
AATTACGATTATTCTGAGGTCCAGGATGGCAGTTACCCCACAAGTTCTTTTATTGTTGAC
AATATTTTTTGTTATACTGAGTTTTTAATTATTCCAGATAAATTTGAGAAATGCTCTATC
TTTGTGAAGAATTGAGTTGAAATTTTATTGGGGATTGCATTGAATCTGTTTAGGATAAGA
TGGACATTTTTACTATGTTATTCCTGCCAATCCATGAGCATGGGAGATGTTTTCATTTGA
TTTCTTCAGAGACTTGAAGTTCTTTTCATATAGACCATTCACTTGCTTGGTTAGAATTTC
ACCAAAATACTTTATATTATTTGTAACTATTTTAAAGGGTGCTGATTCCTTAATTTCTTT
CACAGGCCACTTATCCTTGTGAAGAGAAAAGCTACTGATTTGTTTGAATTCATTTTACAT
GTACCCAGTTTCCTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved