Rattus_norvegicus Locus Mono:365:SNORA32
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:365:SNORA32
Rattus_norvegicus
Mono:365:SNORA32
19
SNORA32
1001..1110
2110
TGGAATTTGGGGGAACTGGAAGGAATGGAGGGAGGGGAAGCTGTAGTTGGGATGTATTG
CATGAGAGAAGTATAAATTATTTGAGAGAGGAGAGTAGTGATACATACTATGTAATTAAA
GACAACTGGTTCTGAAAAAAAACCGAACCATTTGGAATATTAGTTGGCAGGATTATCGTT
GGTAGCACAGGCTTTGTGAAGCCTGTGGGCAGACTCAAAAGAAAGAAAACTGTACATATG
TTCAGTGTTTAAACTGTAGACGTTCGGAAAAAGATACCAATGCACAGGATTGTTCTAGTG
TCTTAAGTGGTATCACTCTGTGGTCAGTAATCCTAGAAGGTACAACATCAAGGATGTCAA
TAAACAGCAAATCTGAATTGGGAGCAAGCAGACTCCATCTGATGCCATCTGTTTGTGCAG
AAGATAAAGTGCACACAATGTTTCCAAATCTCTTGTCCTCAATACCCCATCAGCACATTG
ACTCTGATAAGAGCATAAGGAATAATTTTGGTCCCAGAAAAAGAAAGGTTTTATATTTTT
ATACTGAATGTGTTGACAATAATTCTCTGATTCTTCCTGACATGACCTTAAGAGGAACGA
ATAAGTGCTGGTAGGATGACTCCCGTTATAAGAAGTAAGACTTGTTTGACCTGAAAAATA
ATAAAAGATGTGAAGTCTGTGTCAGTTTGGTACATGGAATTTCATTTTATTCTCAGAGCA
TCAGAAGACAAACTGCAGGAACCATAAATCTTTTTTTGTCTTCATTTAGGTCATCAAGAT
TATGTGATGGCCTTATGAAGGAACGAGGGGGAGAGGGAGGACACAAAACAGTGAAGAAGG
TGGGGGAGGGGCACAAAAAGTCTTCCCATCAAGAGTTGGGTGAAGCAGCATTTTGACACT
AGCATTCCAAAGTAGAAAACCCATACCATTAAGGCATATATCACCAGGCATGGAATAATG
GCGCTAAGTCCAAGCACAACCCAACACCTAGTCAACCTCTGTGCTTAATGTCTCTGCATA
GTGATAGATCTTTAAGTATAAGAATCATAACAAATTCCCATTAGGTTTTCCATATGCTAC
TTGAGTAGCACTTAACCTGTTGGGAACATTTTTTGAGCAAATCTTTATCCAGTTGTTACT
TTATATGTAGATGGTTCTAGAATACTGACTACTCATCCCATTACTCCCATGTTCTTATTA
TGCAGGGCTAAAAAGCACAACTGGATGCCCTTGAGAAAGGGCTATTTTCAGAGTGCCTGG
ATGGACAGCAAAGAAATCAAACCAACCACTTAAATAAAAATTTATTGACAATAAATAATT
TTATACATTAAAAAAAAGAATCATAACAGAAAATTTAGGATTGCCATAGAGCAGATGATT
TTCAAGAAGCACAAATAGTGGAAATAAGGGACATTAAAAATATGAACGACGGTGATGCTT
CTGAGGAGATAGTTCAGTCAATTGCACAAACATGGGATCCCGAGTCCATCCCAAGAACCC
ACATAGATTCTGGGTACGACGATGCACACCTGTCCCACCATTCTTGGTAATGCAGAGAAA
GGCAGGTGTCTAGAGCTTACTACCCATCCAGGCAAGCTGACTCTGAGATCCAGGTTCACT
GAGATCCTCTGCTTCAAAAATATAAACAAATAAAGAGGAAACCAATGGAGGAACACAGTC
AAAATTGAATTTCAGCCTCTGTACACATGATCAGCCTTTTTAACATCCATACATGTACAT
ATATAAAAACCATACATACACAAACTTCATACAAACACACATACTTTTTTTTTAAAAAGA
AGGCAAATAATTCAGTAGAAACAATTTTTATCAATCTTTGGCATTTGTTAGTTTTAATAG
CATGGCCAATGTAGCAAATGGAAGCACTATAAATAAATGAAATAATATATGAGGTAATCA
CCAATTAATTAATCCACATAGTATTTAAAATAGTAAAAATGATCTGGCTCTGCATATATG
AAGCTTTTCTGTAAAGATGTTCCTTTTGGTTTTAAAATGAGAAATGATGTCTCTGGTAAG
CTGATTGACTTAAGGTCATGGTTAGTTACATGGAATGTAAGAATATTTGGCAAACACGAT
CTGTCTACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved