Rattus_norvegicus Locus Poly:20:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:20:SNORD115
Rattus_norvegicus
Poly:20:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2833..2910, 4669..4746, 6507..6584
7584
CTCTTGGGCATATACCCAAAAGATGCCTCAACATATAAAAGAGACACGTGCTCCACTAT
GTTCATCGCAGCCTTATTTATAATAGCCAGAAGCTGGAAAGAACCCAGATGCCCTTCAAC
AGAGGAATGGATACAGAAAATGTGGTACATCTACACAATGGAATATTACTCAGCTATCAA
AAACAACGAGTTTATGAAATTCGTAGGCAAATGGTTGGAACTGGAAAATATCATCCTGAG
TGAGCTAACCCAATCACAGAAAGACATACATGGTATGCACTCATTGATAAGTGGCTATTA
GCCCAAATGCTTGAATTACCCTAGATCCCTAGAACAAACGAAACTCAAGACGGATGATCA
AAATGTGAATGCTTCACTCCTTCTTTAAATGAGGAAAAAGAATACCCTTGGCAGGGAAGG
GAGAGGCAAAGATTAAAACAGAGACTGAAGGAACACCCATTCAGAGCCTGCCCCACATGT
GGCCCATACATATACAGCCACCCAATTAGACAAGATGGATGAAGCAAAGAAGTGCAGACC
GACAGGAGCCGGATGTAGATCGCTCCTGAGAGACACAGCCAGAATACAGCAAATATAGAG
GCGAATGCCAGCAGCAAACCACTGAACTGAGAATAGGTCCCCTATTGAAGGAATCAGAGA
AAGAACTGGAAGAGCTTGAAGGGGCTCGAGACCCCAAAAGTACAACAATGCCAAGCAACC
AGAGCTTCCAGGGACTAAGCCACTACCTAAAGACTATACATGGACTGACCCTGGACTCTG
ACCCCATAGGTAGCAATGAATATCGTAGTAAGAGCACCAGTGGAAGGGGAAGCCCTGGGT
CCTGCTAAGACTGAACCCACAGTGAACTAGTCTATGGGGGGAGGGCGGCAATGGGGGGAG
GGTTGGGAGGGGAACACCCATAAGGAAGGGGAGGGGGGAGGGGGGGTAAGCCATGGTGCA
GGTGAAATTACATTATTGACTGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAG
TAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTATGCTGAGGCCCA
ACCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGCTTGTG
TGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCTTGAGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCC
ATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTTCTCA
GTATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGATAAATTCCTTTCTACCTGT
AGTTCATACAGCCATAAAATTGAATATCTTGGAAGAGATCCTAGATGATAATATCTACAT
AAATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACAC
ACAGGCTCACATATCAAAGCACAGAGATGGATTTCCAATGGCAAGGGGAACCCAGGAATA
AGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCAAAAGACACTCCA
AGAATTATTGCACCAAAGAGAGCTTCGCGAAATTTTTCACGAAACTCTCAGGCCACAGGG
AACCTAGCCAGTAGGGTAGATTGAAGTTGAAAGTGTGGCTTTGGCTACCAATTCCCTTCT
ATGTGTCATCACACAGCTTCATTCTTGATCTTACTAAAATTTACTTCAGTATTCATCAGA
AAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAGGAATGTGATGTCA
CTGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCACATTCTGAGTT
TCATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACATGTTG
CTTTCTTCTGGGCAACAGATTCTCTTCAGCATTCACATACCAGCTGTGGGAACTGATTGT
TACCATGCAGTATGGAAGTGGGGAGGAATGAACATAGCCTAGAACATAAAATCTGAAATG
CACAAGTCTCATGAAAATTTGATTAAAGTATACGTAACTGTTCGTGTATTGTCCTTCCAT
TATTACTCAGGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTAGCAATTGAAAGAT
TTGATCGGTGTATATGGCAAAGAGCATGTGTCATCCCCTTCATCAATGATTTAGTTTTGG
GTACCTATTGACCTATTTATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGC
ATGGAAGTGGATGTTGCAAGAGTGATTCTGCTAAGTGGCATCATACATTAGACTTCTTAA
ACAGCCTCCTTAAAATTAATATGATTGTATGAACTGAAGGGATACAATTCCCCTCACATC
TTGCTCTTTCCATTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGTCTACCCTTATTCCA
CACAAGAGTGCTGTGCCCTTGTACCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAAG
CAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACAGTTGTGT
CCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATGACATAAA
AATCATGCTCCATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGGTTACAAGCACTAC
TTAGTCTCTTTGAGGACCACTTGCTGGACTCATCTGAGCTGCTCTGATGACCTTGTGCTC
TTTTCCGTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACTGCCTGC
CAATTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCCATCAT
CATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCCCTTCGGTCCATTGG
ATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAACTTACTATAAGATA
TTCGTCAGTATTTTGACCAATAATTACAGCCCATCAAAGGTTTCTAATTAAAAATAATGC
AATACCAGTCAGAAATGAATTTCACTTCTCAGTATGTTTTGTCCCTTTGAACTGCACTAT
TAAAAATGTAGAGAAATTCCTTTCTACCTTTAGTTCATACAGTCTTAAAATTGAATTTCT
TGGAAGAGATCCTAGATGATACTATCTACACAAATGGAGGGATCTGGATTATGAATATAC
CTTTGAATTTGGAGAAATTTCAGTCCACACACATGCTCACAAATCCAAGCTGTTGCACCG
AGATCGATTTCCAATGGCATGGGCAACCCAGGAAAGAGACTATAGTTTAGAGATGTAGAA
ATTTGCGACAAATTTTCTGCATCAAAAAACACTCCAAGAATTATTCCCCCAAAGAGAGCT
TGGCGAATTTTTTCACGTAACTCTCAGGCCACAGGCAACCGAGCCAGTAGGGGACATTGA
AGTTGCAGGTGTGGCTTTGGCTACCTATTCACTTCCATGAGTCATCACACTGCTTCATCC
TTGATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGG
TTTCTGGAGCTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTTGCAAACACCAACT
GATCTAGTCACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTG
CTAACGCTCAGGGATTCATGGCCAAAATACCTGTTGCTTTCTTCTGGGCAACAGATTCTC
TTCAGCATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGA
GGAATGAACATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAATTTGATA
AAGTATACGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTG
CCTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGGCAAAGAGC
ATGTGTCATCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTT
AGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGGGA
TTCTGCTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGAT
TGTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGAC
AGTCTTCAAATTCAAGCTAGGTCTACCCTTATTCCACACAAGAGCACTGTGCCCTTGTAC
CCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCC
ATGGTGCAGGTGAAATTACTTTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGAT
GACAACAGAAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCT
GAGGCCCAACCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGACCACTTGC
GGGACTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGAAC
AATCATAGTGCAACTGTGCTGGCAAACACTACCTGCCAACTAGCACCTAATCTCATAATC
TGCTTGTGTGCAAGTCTGCAACACCAACCTTGTCATCATTACCCTCTCTGCTCTGATGTC
TTGCAGTCACCTGGCATCAACCCTGCGGTCCAGAGGATCACTATTCCCAGGTAAGTGAAA
TGGTCACGATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTTCTAATAATT
TCAGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCA
CTTCTCAGAATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTC
TACCTGTAGTTCATAGAGCCATAAAATTGAATATCTTGGAAGAGATCCTAGATGATACTA
TCTACACAAATGGAGGGATCTGGAATATGAATATACCTTTAGAATTTGGAGAAATTTCAG
TCCACACACAGGCTCACAAATCAAAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGG
GAACCCAGGAATAAAACATTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATC
AAAAGACACTCCAAGAATTATTGCCCCAAAGAGAGCTTCGCGAAATTTTTCACGAAACTC
TCAGGCCAGAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCCA
CCAATTCCCTTCTATGTGTCATCACACAGCTTCATTCTTGATCTTACTAAAATTTACTTC
AGTATTCATCACAAAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAG
GAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGT
CACATTCTGAGTTTCATCACATGGCAATCACTGAGTTCTAACGCTCAGGGATTCATGGCC
AAAATACCTGTTGCTTTCTTCTGGGCAACAGATTCTCTTCAGCATTCACTTACCAGCTGT
GGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGCACAT
AAAATCTGAAATGCACAAGTCTCATGAAAATTTGATTAAAGTATACGTAACTGTTCGTGT
ATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTA
GCGATTGAAAGATTTGATCGGTGTATATGACAAAGAGCATGTGTCATCCCCTTCATCAAT
GATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTGT
TGGGAATGTCAGCATGGAAGTGGATGTAGCTAGAGTGATTCTGCTAAGTGGCATCATACA
TTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATTGTATGAACTGAAGGGATACAA
TTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGT
CTACCCTTATTCCACACAAGAGCGCTTTGCCCTTGTACCCTCTGCACTTGCAAGTGAGGA
TTCAAATTCTGAGGCAGTGTTGGCAGCCAAGGTAAGCCATGGTGCAGGTGAAATTACATT
ATTGACAGTTGTGTCCTACCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAGAACAG
AATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGG
GTAACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTG
ATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGG
CAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGCTTGTGTGCAATTCTGCAAC
ACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCC
CTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAA
ATTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTT
AATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTCCTCAGTATGTTTTGTCTC
TTTGAACTGCACTATTAAAAATGTAGAGAAGTTCCTTTCTACCTGTAGTTCATACAGCCA
TAAAATTGAATATCTTGGAAGAGATCCTAGATGATACTATCTACACAAATGGAGGGATCT
GGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACACACAGGCTCACAAAT
CAAAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGGGAACCCAGGAATAAGACTTTA
GTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATAAAAGACACTCCGAGAATTATT
GCCCCAAAGGGAGCTTCGCGAAATTTTTCACGAAACTCTCAGGCCACAGGGAACCTAGCC
AGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCTATGTGTCAT
CACACAGCTTCATTCTTGATCTTANTAAAATTTACTTCAGTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved