Rattus_norvegicus Locus Mono:204:SNORA32
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:204:SNORA32
Rattus_norvegicus
Mono:204:SNORA32
4
SNORA32
1001..1110
2110
TTTTTTAATGAGACAGTTTTTCTGAGACAAAATTTGGCCGGAACTGGCTCTGTAGGCCA
TTCTGGTCTCCAACGCAGAGATTAGCCAAGTCTGCCTCTGGAGTGCTGGGCTTAAAGGTA
TGTTGTGCCACCATTGCCTGGCTGGCTGTGTTTCTGAAAGCGTTTAATTTGTGGTGGCCC
ATATATGTAATTTTTGCCTGTAATTGAGGCAGAAAGACCACCATGAGTTTGAGGCAAGCC
TGGGTTACAGAGTAAGACCTTGTCTCACAAAACCTAAATAAATAAGACCACCTATTGACC
TGATTTTGTTTTCCCCTTACTATGTTAAAGGCTCCTAGAGCACAGTGATTTGTCTACATT
AGATGCAGTTTTAAAAATCTTACAGTTGGGTATGGTGGGCACAGCTGTTAACGTCAGCAC
TTGGGAGGTGGAGGCAAAAGAGTCAGGAGTTCAGCATCATCTTCAGCTACATAGCAAGTT
CAAAGTCAGCCGAGGGTTCCATAACCAACCCTCTTTCAGAACAAGCAAGAACCTTCATTT
TCCTCATTGGCTAATGACCCAGAGCAACACTAGTTTGATATGTATGTGTGTGCGCGTGTG
TGCGCGCACGGGTGTGTTTTAAGTTAAGGAGGAATTCCTTAGCAGTTACCAGATAGACAC
CAAAGAATGCTACAATCCTAACACTCAGGAGGCTGAGGCAGGAGCATTGTTATGAATTCA
GTGCCAATCTGGGCTATAAGCTAGTAACCAGGTCAGTCTGAGTTACATAGCAAAATCACA
TTCCCATCTCCCACCCTTCAAAAAGAATATGGCGGGCTGGAGAGATGGCTCAGTGGTTAA
GAGCTCTTGTCCATGATACAGAGGACCCAGGTTGTTCCCAGCACCCAAATGGCAGCTTAT
AAACATCTATAACTCTAGCTCCAGGAGAGTCAACTCCCTTTCTGACCCTTCGAGCACAAG
CATGCATGTGGCACAAATACATACATGGGGCAAACCAGCCATGCACATAAAATAAATTAA
TTTAAAAAATATGCTACATGATCATAAAGAAAAATTCCTGTTAGGTTTTCCATATGCTAC
CTGACTAGCAGTTAACCTATTGGGAACATTTGCTGATGAGCAAACCTTTACCCAGTTACT
AATGTATGTAGATGGTTCTAGAATGCTCATGCTCATCTGATTACTCCCATGCTCTTATTA
TGCAGGGCTGAACAGCACAACTGGATGACCTTTGAGAAAGGGCTATTTTCAGATGGCCTG
GATGGACAGCAAAGGAATCAAATCCCTTAAATAAAAATTTATTGACCTAAAAAGAAAGAA
AGAATATGCTATATATTTAGGCAATGAATGACAGACATTTCCAAAAGTACAACCCATTAA
AGAGCATACGTGAAGAGGCTCCCATGTTGGCACTCTGGGGGACAGCTCTACCTTTGAGTC
ACCCTAGCTCAGGCACAGCCGCACACGAGATGATTCCACTGGTCCAGTCTGTTTCCAGCT
AGCTTCAGTCTTTCTGGCCACGTCCCCAGATATTGTGTTGCAGAAACAAGCCATTCCCAC
AAGGATCTGTGTGAACCTTTGACCCACAGAATCTATCCTCACAGTACAATGTTAGGAGGA
AGGAAATTCCTGCAATAGGTGAATCTGGAGAAGGGGAAAGAGGCTAGAGATGTAAAGTTC
AAGGCTGTTTGAATAGCCAGGGTTACCATCCCAGCACTGGGCAGCTGAAGGAGGAGGGAC
CACGGGTTAGAAAGAGACTGAGCTAAGCTGCCTGAAGGAAAGGAAGGAAGGAAGGGAGGG
AGGAGGGGTGGGGCTGGGGCTAGAGAGCACAGTGAGGAAAAAAAAGTTCCGTGGCTTTGG
CATTAAACAGCAATGGCGTCCATGATAGAGCTGAGAGGGATTTGGGGAGACAAAGGACAA
ATATTCCATCTGGATGGCAGAAATGACCCAATAGAGCAGTACTGAATGCTGCTCAGTGTT
ATATGCAGGATCTGTTCTGAAACCACCAAACAGCAAAGTCGCCGTATACACCATGAGGGA
TTAATGAACCTCTGGGCAGGCAGATGAGGGATGATGTTGATTCGGTTAGTTGCCGGCTGA
AGAAGCCACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved