Rattus_norvegicus Locus Poly:1:SNORD113
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:1:SNORD113
Rattus_norvegicus
Poly:1:SNORD113
6
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 1866..1940, 2573..2647, 3558..3632, 4271..4345, 5132..5206, 5843..5917, 6709..6783, 7420..7494, 8287..8361, 8992..9066, 9854..9928, 10565..10639, 11433..11507, 15822..15893, 16260..16325
17325
TAGTTCATGTTGTAAAACATGATTGTTAAAAGCAAATGCTTTCAAAATTGAAGATGGAA
TCTATGATTCATTAACTATACATGGAGTTTGGAGGGTAATTAACATACATTTTAATATAT
TGCTGGTCTATGAGTTCACCACATGAATAATTAAAGATTGGATGTAGATGACTGAGAGAA
GTGCCAAAAAGAAGGAGATGGTACAATTATACGATATCATTTCAGTGCTGATTGGTGACT
ACGAGTGAACAGAAGTTGGAGGTCAAGGACACTGAGGACTTTACTGCCAAGTTAGAGATA
AGCACGACGCATACAGCCTAAACCTTGTGAATCTTTGGTTCGTGGACTACATAAAGTTAT
CAAGGAAGATTGAGAGATGTGAGTTGGCTGAATTGAAGTTTGGTAGCTAAAGCAAGGTTC
CAAAAGCGAAAAGGGAATGGTAGCAAATGCTAGAGGAGACATTTGGTAATAATATTACTC
GCAAGAAAGGCTAATGCAGACAATCTGGATTAGAATGGGGTCATCCTGGACTACTTAATA
ATCTACTTGACTAGGAGGGAAGGTCACCCCATTCCCATAGTGAGAAAACCTGCAAGACAA
CGCCCTTCAAATGTAGGAATTGGGGGCCATCCTTGAGACCAAGTGTCAATATTTCTATTT
CCTTCTCTGCCTTCTACCATCCAGAGAGATTTCCCAGTGATCTCAAAGGGTTGCAGTGAC
AGATAGATCCTGGGATGCCGTGGTAACAGTACAGAGCTGCAGCTGCAGCTTTGATCGTTC
AGTGGGCACTTACTGATAGGTATGGAAGGACTAATCAGAACACCAAAACACGGGAAGTTA
AGCAGAGTATGGTGAAAACCAATTAATCTAGTGTTAGCTCCAGGACTAGGCAATGAGATA
CCATAGCACAGGGTAGTCTTCTACAGTGTGGTCTCCCGAGCATACCACACTAGCCCACGA
GTGAGCCATTTCCAAAGGCTCAAGAGAGAGGAGCCCAACTGAGGACCAATGATGAGATCT
GGTGGCATCTGAGTGTTTCTCGATGACAGCCTTGTGAACAGATATCTGAGGTCAGACACA
AAGCAACTTCAGCTGGGCTGCATTTTTAGGCTAGCCTATGGCCTAAGAAAAGTAACACAC
TTTAGGACTTTGCCCTGACTTTAACCTGTTTCCATTAGACAAGGAAACATGGCTGGCAGA
TAGGCAATGTTGGGGGAGAGGGCTTGGTACCATGGCCAGTGCTTACTGACAGAGCAGCAC
ATCTTTAAAACTCCAGGGGGTGTGTTGAGTGATACTGGCAATGAAGTGCAGGCCCCATGA
CGTATGGCATAGTAGAGACCGAGGCCAGCCTGTTCTTTTTCCTGGGAAATAGAAATAAAT
TAGTGTCCCCTGGGAAGAGAAAACACAATTATTGCCTAGGCAAACTTTAAGAGCCTGGGC
TCCATAACAATGGAGGGCACAGAATGATACCCACAGACCATCAAAGGTATCTCTTCTTCT
CTGCCCTTTATTCTTCAGAAAAATGGACTGGACATGTGGTACAAGTGTGCTCAAATCCAG
AACCCACCTAAATCTTCACTATGACAACCCTGAGACTTGCTGACATAGAGGCGACATCAC
GATCTTCCTTGGCCACCAGCTTATAGGTATGTGTAGTGGCAGGAAAATGTTCCTGAATTC
CTGTGGTAGAATGAGAGTGCTAGAGCATTAGCACAATAGTTAGTAGTGATTTCTGGGTTG
TTTTAATGGATGCTTTTTAGGCACCAGCACCCAGAATATTGTGGACCCTGATATCAGTGC
TCTGCCCTCAGCACCCACTATGAAGTGAAACCATACAATAGGCTAGGGAGAGCAGGGGCC
TCAACCAGGACCGGTGATGAGATCTGGTGGTGTTTGAGTGATATTCCATGACCGCCAAGT
ATCCAGATATCTGAGGTCAATCCCGATACCTTGCTAAGAGCTAATCTGTGGATGGAGGCC
CATAGGCAGATGCCTATCCCTTGAAGACCTGTGGTGAGATGAGGGCTTGGGTGCTCTTTG
ACCATGGTACTCAGCATCAAAGATGGGGAAGCTTGAGGTCTGCCCTGCAGCTGGGTCAGA
ATGGCCTTGATGATCTACCTGAATGTGAGGGAAGGCCACACCCACTTCCTTAGAGAGAAA
GTCAGGGAGACAGCACCCTTGAAATGGAGGAATTCTGAGCTATCTTAGGGAGCAGGACTC
AATAATCCTTTTCCTCTTTCTGCCTTCTCCCCTCCATGAAGATGACCCTGCTGATGGCTG
ACGTTGCAGTGATGGACAGATCCTGGGATGCCATGGCAACCGTCCCGAGCCCATGGGGAC
TTGACAGCTCCAGCTCTCATCCTCCCGTGGGCACCTGCTGATAGGTATGGAGAATGTTAT
GATAACATGGGTGGTTAAGCAAAGTAAAGGAAGAGTTAACTTAGTACTAGCTTGAGGCAG
TGTGATGCCAGAGCACTGCACAGGGAAGTCTGCTACAGTGTGGTCTCCCGAGTATGCCGC
AGTAGCCAAGGAGTGAGCCATTCCCGAAGGCTCAAGAGGAAGGAGCCCAACCCGGGACCA
ATGATGAGATCTGGTGGCGTCTGAGTGTTTCTCAATGACAGCCTTGTGAACAGATATCTG
AGGTCAGACACAGAGCAACATGACTTGGTCCTTCCATGAGAACTAGCTTCTTTACTTTGA
GTCACAAGAGCAAGTTCGAACTCTCTTGTCAACTTGGCTTCAGAAGCCAACCAATTGCCA
TGAGCCATGAATACGTGGTGGGCCAATAGGTAAAGTCAGGGTGAACCAAGTGTGGCCATA
ACCTGTGCCTTGTTGGGCAACTGCACAGCTTGTAGTCTCCTGTGGGTGCACTGACTGATG
GGGCAACGACGTGCTGGCCCCGTGCAGGGTGCCACAATGTAGACAGAGGTCAGCCACTTT
CTTGGCCAATGGCAAGAAATTGGTTTCTCCTGCTACTAGAAAAAATAGGTACAGCCTAGG
GAAAGCCGGTGTTGTCTAACTAGAGAGGTCATGGAGTAGTACCCACAGAGGCTCAGCAGT
GTCTGTCCCTTCTCTGCCCTGTACCCTTTAGAAAAGCTGACCCAACAGATGGTACCAGCA
TGCTGAGATCTGGAATCAACCTTGCTTCCTTGCTGTGACCACCCCAAGCTCTGCTGACTG
AGAGGACATCTTAATCTTCCTCGGTCCTGAGGTTATAAGTATGTGTACTGTCCGGAGAGT
GTTTCTACCTTAGTGCAGTAGCATGCGAATGTTAGAGCATTAGCGCAATAGGTAGCAGTG
ATTTCTGGCTTCTTGTAATGGCTGCCATTTGGGGAGCATCACCCAGAGTATTCTGGTACC
CTGTAGTCTGAGTTCTGCCCTCAACACCCACTAAGAAATGAAGCCACACGGGGTTGGGGA
TTTAGCTCAGTGGTAGAGCACTTGCCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGC
TCCGGAAAAAAAAGAACCAAAAAAAAAAAAAAAGAAATGAAGCCACACAGTAGTCTAGGG
AGAGCAGGGGTCCCATCGAGGACCGATGATGAGATCTGGTGGCGTTTGAGTGATATTCCA
TGAACGCTAAGTATCCAGACATCTGAGGTGAATCCCGATGCCTTGCTAAGAGCTAATCTG
TGGATGGAGGCCCATAGGAAGATGCCTGTCCCTTTAGGACCTGTGGTGCGAGTGAGGACT
TGGGTGCTCTTTGATCATGTTACTCAGCATCAAGGATGGGACAGCTTGAGGTCGACCCTA
GAGCTGGATCAGACTGGGCTTGATGATCTACCTGAATGTGAGGAAAGGCCACACCCACTG
CCTTAGAGAGAAAGTCAGGGAGACAGCACCCTTGAAATGGAGGAATTCGGGGCTATCTTA
GGGAGCAGGACTCAATAATCCTTTTCCTTTTTCTGCCTTCTCCCCTCCATGAAGATGACC
CTGCTGATGGCTGATGTTGCAGTGATGGACAGATCCTGGGATGCCATGGCAACCGTCCAG
AGCCCATGGGGACTTGACAGCTCCAGCTCGCATCCTCCTGTGTGCGCCTGCTTATAGGTA
TGGAGAATGTCATCATAACATGACATAGTTAAGCTAACTATGTCAAGGAAGAGTTAACTT
AGTACTAGCTTGAGGCAGTGTGATGCCAGAGCACTGCACAGGGAAGTCTGCTACAGTGTG
GTCTCCCGAGTATGCCGCAGTAGCCAAGGAGTGAGCCATTCCCGAAGGCTCAAGAGGAAG
GAGCCCAACCCGGGACCAATGATGAGATCTGGTGGCGTCTGAGTGTTTCTCGATGACAGC
CTTGTGAACAGATATCTGAGGTCAGACACAGAACAACATGACTTGGTCCTTCCATGAGAA
CTAGCTTCTTTACTTTGAGTCACGAGAGCAGGATCGAGGTCTCTTGTCAACTTGGCTTCA
GAAGCCAACCAATTGCCATGAGCCATGAATACATGGTGGGCCAATAGGTAAAGTCAGGGC
GAACCAAGTGTGACCATAACCTGTGCCTTGGTGGGCAACTGCACATCTTGTAGGCTCTGG
GTGCATTGACTGATGGGGCAATGAGGTGCTGGCCCCATGCAGGATGCCACAATGTGGACT
GAGGCCAGCCATTTTTCTTGGCCAATGGCAAGACATTTCTTTCTCCTGCTAACAGAAAAA
AATAAGTGCAGCCTAGAAAAGCCTGTGTTGTCTACCTGGAGAGGTCATGGAGTAGTACCC
ACAGAGCCTCAACCGTGTCTGTCCCTTCTCTGCCCTGTACCCTTTAGAAAAGCTGACCCA
ACAGATGGTACCATCATCCTCAGATCTGGAATCAACCTTGCTTCCTTGCTGTGACAACCC
CGAGCTCTGCTGACAGAGAGGACATCTTAATCTTCCTCGGTCCAGAGTTTATAAGTACGT
GTACTGGCGGGAGAGTGTCTGCCTTAGTGCAGTAGCATGGGAATGTTAGAGCATTAGCGC
AATAGGTAGCAGTGATTTCTGGCTTCTTTTAATGGCTGCCATTTGGGGAGCATCACCCAG
AGTATTCTGGTGTCCTGTGGTTAGAATCTGCCCTCAGCACCCACTAAGATGTGAAGCCAC
ACAGTAGGCTAGGGAGAGCAGGGGTCCCATGCGGGACCGATGATGAGATCTGGTGGCGTT
TGAGTGATATTCCGTGAACACCAAGTATCCAGACATCTGAGGTCAATCTCAATGCCTTCC
TAAGCGCTAATCTGTGAATGGAGGCCCATAGGCAGATGCCTGTCCTTTGAGGACCTGTGT
TGCCAGTGAGGGCTTGGGTGCTCTTTGATCATGTTACTCAGCATCAAGGATGGGGCAGCT
TGAGGTCTGCCCTAGAACTGGGTCAGACTGGGCTTGATGGTCTACCTGAATGTGAGGGAA
GGCCACACCCACTGTCTTAGAGAGAAAGTCAGGGAGACAGCACCCTTGAAATGGAGGAAT
TCTGGGCTATCCTAGTGAGCAGGACTCAATAATCCTTTTCCTTTTTCTGCCTTCTACCCT
CCAAGAATATGACACTGTGATGGCCAAGGTTGTAGTGATGGACAGATCCTGGGATGCCAT
GGCAACCGTCCAGAGCCCATGGGGACTTGACAGCTCCAGCTCTCATCCTCCTGTGGGCAC
CTGCTGATAGGTATGGAGAATGTCATCATAACACGGGTGCTTAAGCTAACTATGTAAAGG
AAGAGTTAACTTAGTACTAGCTTGAGGCAGTATGATGCCAGAGCACTGCACAGGGAAGTT
TGCTACACTGTGGTCTCCCGAGTATGCCGCAGTAGCCAAGGAGTGAGCCATTCCCGAAGG
CTCAAGAGGAAGGAGCCCAACCCGGGACCAATGATGAGATCTGGTGGCGTCTGAGTGTTT
CTCGATGACAGCCTTGTGAACAGATATCTGAGGTCAGACACAGAGCAACATGACTTGGTC
CTTCCTTCAGGACTAGCTTCTTTACTTTGAGTCACGAGAGCAGGATCGAGGTCTCTTGTC
AACTTGGCTTCAGAAGCCAAGCAATTGCCATGAGCCATGAATACATGGTGGGCCAATAGG
TAAAGTCAGGGCGAACCACGGGTGACCATAACCTGTTCCTTGTTGGGCAACTGCACAGAT
GGCTTCTCCTGTGGGTGCATTGATTGATGGGGCAACGACGTGCTGGCCCCATGCAGGATG
CCACAATGGGGACTGAGGCCAGCCATTTTTCTTGGCCAATGGCAAGTAATTGGTTTCTCC
TGCTAACAGAAAAAATAGGTGCAGCCTAGATGAAGCCTGTGTTGTCTAACTGGAGAGGTC
ATGGAGTAGTACCCACAGAGGCTCAACAATGTCTGTCCCTTCTCTGTCCTGAACCCTTTA
GAAAAGCTGACCCAACAGATGGTACCAGCATCCTCAGATCTGGAATCAACCTTGCTTCCT
TGCTGTGACAACCCCGAGCTCTGCTGACAGAGAGGACATCTTAATCTTCCTCGGTCCCGA
GTTTATATGTACGTGTACTGGCGGGAGAGTGTTTCTGCCTTAGTGCAGTAGCATGGGAAT
GTTAGAGCATTAGCGCAATAGGTAGCAGTGATTTCTGGCTTCTTTTAATGGCTGCTCTTT
GGGGAGCCTCACCCAGAGTATTCTGGGACCCTGTGGTGAGAGCTCTGCCCTCAGCACCCA
CTAAGAAGTGAAGCCATACAATCGGCTAGGGAGAGCAGGGGTCCCATCCGGGACCGATGA
TGAGATCTGGTGGCGTTTGAGTGATGTTCCATGAACGCCAAGTAACCAGACATCTGAGGT
CAATCTCAATGCCTTGCTAAGAGCTAATCTGTGGATGGAGGCCCATAGGCAGATGCCTGT
CCTTTAAGGACCTGTGGTGGGAGTGAGGGCTTGAGTGCTCTTTGATCATGTTACTCAGCA
TCAAGGATGGGGCAGCTTGAGGTCTGCCCATGAGCTGGGTCAGAATGGCCTTGATGATCT
ACCTGAATGTGAGGGAGGGCCACACCCACTCCCTTAGAGAGAAAGTCAGGGAGACAGCAC
CCTTGAAATGGAGGAATTCTGGGCTGTCTTAGGGAGCAGGACTCAATAATCCTTTTCCTT
TTTCTGCCTTCTCCCCTCCAAGAAGAAAACCCTGTGATGGCCAAGGTTGTAGTGATGAAC
AGATCCTGGGATGCCATGGCAACCGTCCAGAGCCCATGGTGACTTGACAGCTCCAGCTCT
CATCCTCCTGTGGGCACCTGCTGATAGGTATGGAGAATGTCATCATAACACGGGTGGTTA
AGCTAACTATGTAAAGGAATAGTTAACTTAGTACTAGCTTGAGGCAGTATGATGCCAGAG
CACTGCACAGGGAAGTTTGCTACACTGTGGTCTCCCGAGTATGCTGCAGTAGCCAAGGAG
TGGGCCATTCCCGAAGGCTCAAGAGGAAGGAGCCCAACCCGGGACCAATGATGAGATCTG
GTGGCGTCTGAGTGTTTCTCGATGACAGCCTTGTGAACAGATATCTGAGGTCAGACACAG
AGCAACATGACTTGGTCCTTCCTTCAGGACTAGCTTCTTTACTTTGAGTCACGAGAGCAG
GATCGAGGTCTCTTGTCAACTTGGCTTCAGAAGCCAACCAATTGCCATGAGCCATGAATA
CATGGTGGGCCAATACGTAAAGTCAGGTCGAACCAAGTGTGACCATAACCTGTGCCTTGG
TGGGCAACTGCATAGCTTGACTTCTCCTGTGGGTGCATTGATTGATGGGGCAACGACGTT
CTGGCCCCATGCAAGATGCCACAACGTCCACTGAGGCCAGCCATTTTTCTTGGCCAATGG
CAAGTAATTGGTTTCTCCTGCTAACAGACAAAATAGGTGCAGCCTAGACAAAGCCTGTGT
TGTCTTAACTAGAGAGGTCATGGAGTAGTACCCACAGAGGCTCAACACTGTCTGTCCTTT
CTCTGCCCTGTACCCTTTAGAAAAGCTGACCCAACAGATGGTACCAGCATCCTCAGATCT
GGAATCAACCTTGCTTCCTTGCTGTGACAACCCCGAGCTCTGCTGACAGAGAGGACATCT
TAATCTTCCTCGGTCCCGAGTTTATAAGTACGTGTACTGGAGGGAGAGTGTTTCTGCCTT
AGTGCAGTAGCATGGGAATGTTAGAGCATTAGCGCAATAGGTAGCAGTGATTTCTGGCTT
CTTTTAATGCTGCTCTTTGGGGAGCAACACCCAGAGTATTCTGGTACCCTGTGGTGAGAG
CTCTACCCTCAGCACCCACTAAGAGGTGAAGCCATACAATCGGCTAGGGAGAGCAGGGGT
TCCATGCTGGACCGATGATGAGATCTGGTGGCGTTTGAGTGATATTCCATGAACGCCAAG
TAACCAGACATCTGAGGTCAATCCCGATGCCTTCCTAAGCGCTAATCTGTGAATGGAGGC
CCATAGGCAGATGCCTGTCCTTTGAGGACCTGTGTTGCCAGTGAGGGCTCGGGTGCTCTT
TGATCATGTTACTCAGTATCCAGGATGGGGCACCTTGAGGTCTACCCTACCCTAGACCTG
GGTCAGACTGGGCTTGATGGTCTACCTGAATGTGAGGGAAGGCCACACCCACTGCCTTAG
AGAGAAATTCAGGGAGACAGCACCCTTGAAATGGAGGAATTCTGGGCTATCCTAGTGAGC
AGGACTCAATAATCCTTTTCCTTTTTCTGCCTTCTCCCCTCCAAGAATATGACACTGTGA
TGGCCAAGGTTGCAGTGATGGGATGCCATGGCAACCGTCCCGAGCCCATGGGGACTTGAC
ATCTCCAGCTCTCATCCTCCTGTGTGCGCCTGCTTATAGGTATGGAGAATGTCATCATAA
CATGGGTGCTTAAGCTAACTATGTAAAGGAAGAGTTAACTTAGTACTAGCTTGAGGCAGT
GTGATGCCAGAGCACTGCACAGGGAAGTCTGCTACAGTGTGGTCTCCCGAGTATGCCGCA
GTAGCCAAGGAGTGAGCCATTCCCGAAGGCTCAAGAGGAAGGAGCCCAACCCGGGACCAA
TGATGAGATCTGGTGGCGTCTGAGTGTTTCTCAATGACAGCCTTGTGAACAGATATCTGA
GGTCAGACACAGAACAACATGACTTGGTCCTTCCATGAGGACTAGCTTCTTTACTTTGAG
TCACGAGAGCAGGATCGAGGTCTCTTGTCAACTTGGCTTCAGAAGCCAACCAATTGCCAT
GAGCCATGAATACATGGTGGGCCAATAGGTAAAGTCAGGGCGAACCAAGTGTGACCATAA
CCTGTGCCTTGGTGGGCAACTGCACAGCTTGTAGTCTGTGGGTGCATTGATTGATGGGGC
AATGAGGTGCTGGCTCCATGCAGGATGCCACAATGTGGACTGAGGCCAGCCATTTTTCTT
GGCCAATGGCAAGAAATTGTTTTCTCGTGCTTAGAAAAAATAGATACAGCCTAGGAAAAG
CCTGTGTTGTCTAACTGGAGAGGTCATGGAGTAGTACCCACAGAGGCTCAACAATGTCTG
TCCCTTCTCTGTCCTGTACCCTTTAGAAAAGCTGACCCAACAGATGGTACCAGCATGCTG
AGATCTGGAATCAACCTTGCTTCCTTGCTGTGACCACCCCAAGCTCTGCTGACTGAGAGG
ACATCTTAATCTTCCTTGCTCCTGAGGTTATAAGTACGTTTACTGGCGGGAGAGTGTTTC
TGCCTTAGTGGAGTAGCATGGCAATGTTAGAGCATTAGCGCAATAGGTAGCAGTGATTTC
TGGCTTCTTGTAATGGCTGCCATTTGGGGAACATCACCCAGAGTATTCTGGTACCCTATA
GTCTGAGCTCTGCCCTCAACACCCACTAAGAAATGAAGCCACACAGTAGTCTAGGGAGAG
CAGGGGTCCCATCGAGGACCGATGATGAGATCTGGTGGCGTTTGAGTGATATTCCATGAA
CGCTAAGTATCCAGACATCTGAGGTGAATCCCAATGCCTTGCTAAGAGCTAATCTGTGGA
TGGAGGCCCATAGGCCGATGCCTGTCCCTTGAGGACCTGTGGTGCGAGTGAGGACTTGGG
TGCTCTTTTATCATGTTACTCAGCATCAAGGATGGGCAGCTTGAGGTCTACTCTAGAGCT
GGATCAGACTGGGCTTGATGACCTAACTGAATGTGAGGAAAGGCCACACCCACTGCCTTA
GAGAGAAAGTCAGGGAGACAGCACCCTTGAAATGGAGGAATCTGGGCTATCTTAGGTAGC
AGGACTCAATAATCCTTTTCCTTTTTCTGCCTTCTCCCCTCCATGAAGATGACCCTGCTG
ATGGCTGACGTTGCAGTGATGGACAGATCCTGGGATGCCATGGCAACCGTCCAGACCCCA
TGGGGACTTGACAGCTCCAGCTCGCATCCTCCTGTGTGCGCCTGCTAATAGGTATGGAGA
ATGTCATCATAACATGACATAGTTAAGCTAACTATGTAAAGGAAGACTTAACGTAGTACT
AGCTTGAGGCAGTGTGATGCCAGAGCACTGCACAGGGAAGTCTGCTACAGTGTGGTCTCC
CGAGTATGCCGCAGTAGCCAAGGAGTGGGCCATTCCCGAAGGCTCAAGAGGAAGGAGCCC
AACCCGGGACCAATGATGAGATCTGGTGGCGTCTGAGTGTTTCTCGATGACAGCCTTGTG
AACAGATATCTGAGGTCAGACACAGAACAACATGACTTGGTCCTTCCATGAGGACTAGCT
TCTTTACTTTGAGTCACGAGAGCAGGATCGAGGTCTCTTGTCAACTTGGCTTCAGAAGCC
AACCAATTGCCATGAGCCATGAATACATGGTGGGCCAATAGGTAAAGTCAGGGTGAACCA
AGTGTGACCATAACCTGTGCCTTGGTGGGCAACTGCATAGCTTGACTTCTCCTGTGGGTG
CATTGATTGATGGGGCAACGACGTGCTGGCCCCATGCAAGATGCCACAAAGGGGACTGAG
GCCAGCCACTTTTCTTGGCCAATGACAAGTCATTGGTTTCTCCTGCTAACAGAAAAAATA
GGTGCAGCCTAGACAAAGCCTGTCTTGTCTTAACTAGAGAGGTCATGGAGTAGTACCCAC
AGAATCTCAACCATGTCTGTCCCTTCTCTGCCCTGTACCCTTTAGAAAAGCTGACCCAAC
AGATGGTACCAGCATGCTGAGATCTGGAATCAACCTTGCTTCCTTGCTGTGACAACCCCG
AGCTCTGCTAACAGAGAGGACATCTTAATCTTCCTCGGTCCCGAGTTTACAAGTACGTGT
ACTGGCGGGAGAGTGTTTCTGCCTTAGTGCAGTAGCATGGGAATGTTAGAGCATTAGCGC
AATAGGTAGCAGTGATTTCTGGCTTCTTTTAATGGCTGCTCTTTGGGAAGCCTCACCCAG
AGTATTCTGGGACCCTGTGGTGAGAGCTCTGCCCTCAGCACCCACTAAGAAGTGAAGCCA
TACAGTAGGCTAGGGAGAGCAGGGGTCCCATCCGGGACCGATGATGAGATCTGGTGGCGT
TTGAGTGATATTCCATGAACGCCAAGTAACCAGACATCTGAGGTCAATCTCAATGCCTTG
CTAAGAGCTAATCTGTGGATGGAGGCCCATAGGCAGATGCCTGTCCTTTAAGGACCTGTG
GTGGGAGTGAGGGCTTGGGTGCTCTTTGATCATGTTACTCAGCATCAAGGATGGGGCAGC
TTGAGGTCTGCCCAGGAGCTGGGTCAGCCTGGGCTTGATGATCTACCTGAATGTGAGAGA
AGGCCACACCCACTCCCTTAGAGAGAAAGTCAGGGAGACAGCACCCTTGAAATGGAGGAA
TTCTGGGCTGTCTTAGGGAGCAGGACTCAATAATCCTTTTCCTTTTTCTGCCTTCTCCCC
TCCAAAAGAAGACCCTGTGATGGCCCAGTTTGCAGTGATGTACAGATCCTGGGATGCCAG
GGCAACAGTTCCAAGCCCATGGTGACTTGACACCTCCAGCTCTCATCCTCCTGTGGGCAC
CTGCTGATAGGTATGGAGGGTCCAATCACAACATGGGGGTTCAGCAGAGTATAGACAGAA
AGAGTTAAATTAGTGCTATTTTGAGGACCAAGCAGTGTGATGCCACACTTGCCAAGCAAT
AAGCCAATCCTGGGAGAGAGGAACCCAGCCTTCCCATGCTAGCCTCTGTAGTATGAATAG
GCACAGCAGGATCACTCTTGCTCTCTACACTCCTGAATCTGATCAGTTTTCCTTAACAAG
GAAACACGGCTGGCAGACAGACAAAGTTGGGTTAAAGTAGATAGAACCACAAACTTGCAT
CGGGAGTGACTCACAGCTTGGAAATTGCAAGGAACATATTGAGAGATGGTTGTACTGACA
TTTGACCCCATGCATGATGCAGTGGCATAGACTGGGCCCACCTCTTTTTCCCTTCAAATA
ACAAGAAATTAGTCTTTTCTGGGAAGAAAAGGTACAGGTGCAGCCCAGGCGAAGTCTGTG
ATTCTAAGTTCTCCAACTGTGGAGAGCATGGAGTGGTGATTCACAGTCTCAGCAGTTTCT
CTCTCTTCATTGCCCTTTATTCTTCAGAAAGGCTGACCTGGTTGATGCAGAACCACCATG
GCCTCCCTGCCTGTCCCAAATTAGCATTCTGTCTTGTGTGGAGCCTGGTTCAAGGTCTTA
ACTTTTAATTGTCAGTTGTTGTAAGAATTTACATGTTTGTTGTAAAATTTACATATTTGT
TGTAAAATTCACATGTTCATCAATTGTGAAACCAAATCAGTGAAGTGTAATTCGGTACGT
GGATTGCCATTGATCAGATTCAGTGTAACATTTACACTAAGTTCATTCTAAAGGCTCAGT
ACACCCAGTTCCATGGCATGAAAGTCTGCTTATGAGTCTCGTGAGTCGACGGAATTTTTG
GTCTGATAATAGGACTTTTCATCATGTCTTTCCTTTTTTTTCTGCTTCTCGTTTTCCCAT
AAAGCTGATCGGTTTATGTTTGCAGACATTTTATGTTATAGATACCTCCTCTGATGTCCC
TTCAACACCACTACAACTAGTATTCACTTTAGTGTCATTTTGTGCAGGGCATGGTAAAAC
CACGTAGTAATATGGCAGAGTTCTTCATATGTGGCGTGTGTAAGATTAATAATATAGCAT
TAGTTTTAACTTCAGAATGCAAAACCAAATGCTTTCACGTAGGTTTTCATTTTTTTTCTA
TTTCATATTAAATGTATCATTTCCATTTTAGGTTAGTTTTTTTCCCCTGGTACATTTATG
TTATTTATGATAATAATCATGTTTAGCATATCACTACCTATGCATATCATATTTCGTATT
AATATTATCATTCCTATTAATAACCACTAAGTTCTTCTAAATGTTAAGCCACACTCAAAT
GTTCCCATACCCGACTTAGACTGTCCATGATAACGTTGAGAAAGTGCAACATGTATTCAG
GGCCATGAGTCATTCATGATTCTTTCACAGCACACATTCTGCAAATAGTTAGTGCTCATC
AATCAGTAAAGTAGCAACGTCATATGAGTCAGCGCTTCCGCCTGGGGGAAGGGGTAAGGA
AAATATGGTGACGTGAGTTCTTACCACCCTGTCCTGAGTCAGATCCATATAGAACAGTTC
CTTACCATTTCTTCTTTTACTAATGATAATGCAAACATTACATCTTATAGCTGATGTTTA
TGTTCTGGATAGTAAAGAATTCCTCATTATTTAGTGAAGAATTAGATATATCACTGTGTA
AGTCAAAATTGAAAACCATTGCTCTTTTATCTGCTTTTAAAAGTCATTTTTTCAACTTCT
TGTTTGTGTTTTGTCTGTTGCTCCCCACACAGGGTCTGGAGCTGGTTTCAGAATTCCCTG
TGTTTAAGGACCGCATCAAGGTAAGCATTGGTAAAAGCCATACATTTTGCCCATATTTTG
GTTAGCATCATTGTATTTTTATATAGCATGAAGTAGAATCTTCTAAGCCCACCCTGACCT
TGTCAGGGGTGAAGATGGGCTTGTATACTGAATAAGTACAATATCTGGGTAGCACATGTG
TTTACATATCGTTGTGAGCACCAACCTGAATATATCAGAGAGCTTTGCTCCTGTTGAATA
TTTGTATATCATGAGTTTTCCTAGTGAATTATTGGCTTAGGCAGTAAACGGTATCTATGG
GAACGAGGAACGGTCAAGTCACATCTGGACCAGTGATGATAGTTACCAAGGTATGAGAGA
GATGATGAATAACATTTGCTTGAAGCTCAGAAGTCCAATCCAATAGACAGATAGAGAAGC
AAAGGTCCTTGAAGGAGAATGACATCTTTCCTTTCCTTTGCATTCTGTTCTGTACTCCTC
AGAATGTGTGCTCCAGGGGTGATTTCTGCATTCTTCATGGTCACCAGTGGAACGTTTGCA
TCTCTGCGTTGAGCTTGGGGCAGTGTGAGTACTAGTTACTATCCCTGCTTTTTTATGTGG
TCTGTTGAAAGTTGGTTACTTCATTATTGAAAAGTATCTAATACAGAGCTGGTAAGGTAG
AAAGAGAGAACTGATTCCTAGACATTATACCCTTTCCTCCATGCACATGCCCTTGGCATG
CATGCTTATAAACACAAATGAATATATTCAATGAAAATAAGTTTTAATTACAGTGTATCA
GTGGAAATATAACCAATGACACCTACAAACTTAATGTGAAATAGGACATTGAGTTGACCA
TGTTTGATAAACATGGACTCCTCACTGAAGGAGGTAAAGTGGTTCAGTAGAGAGGAGTGG
CTTTCAGTCTGTGTCAGTGCTTGGGGAAAGAAATATTCTTTCCATTTTTATTTGTGAATT
AATGATTCAATCAAGACCCAACATAAAAGTGTGTAGAGCCAGAGTGGGTTGATGGTGAAT
GCAAGGATATGAATCCAGGATGGTATACGTGTGCCCGTCCCTGGGTCCATCCTGTAGCAG
ATCTGCTCTTAATTTCTTGAATAGTGAACAAATATAGAAAATCATGAAGATAAACGATTG
AAATTCTATTCACTTATGAACACGAGTATCAAGGCAAAACAAACAAACAAACACACTCCC
CTTAGTAACTGAGAATATGGAATCCAAAGAGGAGAAAGTGGCATCCAAGCCCTTTTGTGT
ATAGAGAAACTAATGTCAATACCAGATGCTATTTTCTTGCTTTGCTGGAAGTTTAAAGAT
ACTCATCTTAGAAGACAATAGTATAAATATTTTTAAATTATGGTGGCTTGCATGAATGAT
TCAGATGACAGATAATCATCAAAGAGAAAGCAAGAAATGTTTTTCTAAGTACACTTTCCT
CAGAGCTGGTGCTCTCGCGTACTGACATGTTTATCCATCTGTGTAGATAGAGCCTGAGAC
AGATATGAGTTCCAGTGCTCTGTCCTTTGCTGCCTTCTCTGTAACTATTTCATTATCCTC
TTCTCTCCTCTCCTCCTCCCTCCCCTTCCCTCCCTTCCTCTTCTCCTCCCTCTTTTCTGT
ACTCAAGATGGACCGTGTGATTAGAAGATCGTCCAAGGGTCAAGGGCTCCATTTGCACCC
TGTCGAGGAGGCGAGGAAGACGAGTGTGAGTTACCGGATTCTCCTTGTCTTGGTTTGAGT
GTTTTAATGTAGTGGTTAAGCAGTGTATAGTGTAGGTAGAGATGACCATTTGAGTACCAG
TGATAGATAGGGCGACTACATGACATTGTCCATGAGTAATTCAACTATGTTAACTAGAGT
GAATTGTTATATGATGGACATATTATAAAAATCCCATTTCCAGATTACGAATTACTAGAC
TCAGATTCAGTTTTTTCGTCAGTAGGAGTTACTAATCATAGGGTTTATAACTAAGTAATT
AATAGGGAACGTAAAAATAATTAAGGAGACAGAGAGCTAATCTTGGTTGATGATGACAAA
CGGTGGCATTTGAATCATCCATGATGACTATGAGTCTGAAAACCAAGATTCAATAGAGAA
GATAAGTGGCTACATGAAGATTGGTAGCAATGGTGTCATTGCTTTGTCCTCTGCTTTGCT
CTGTGTTCCTTAGAATGGACTTTCCCAAGAAATCTATTCATCTTCAATGGCTTCCACCCC
ATCAGTTGCTTGTGATGATGTGCGATCTGCCCAAACTTCTTCTCATAGTTTTGATGGTTT
GTAGAAGGTTAGTCCCTTTGTTACTAAGGGGTGGAACATATTCACACTAGGTCAAGGGTA
ACAGATTACATATATGGAGTTAGTATAAATTTTATGCATATGTGTTTAAAGTAGGTTTTT
ATAGAATGATTCATTCATGGACATGATATAGGAATTAGTGGAGACAAATAGGACTAGTCT
TGGATTGATGATGGCCACTCGTGGCACATTTGAGCTACAAATAGTGACTAAGTCTCTGAG
GTCCACCATAAAGTCCAGGTGTCAACAATAGAAGGAGAAGTGACTCTGGTTCTCATTCAT
AAATATGCATTTCCTGCTCTTCTTAAAGTTGGATGATGCAAGAATCAATCCATCTACAAA
TAAAGATAAATAAGATTAGGTATGGTCCAATTATAAAAATACATGATGAACAAGAAATAC
TTTTTAGGTCAAATAGGATTATGCATATCCGCTTTTCAGCCAACAGTGAAAGTTACAACC
TAAAGCATAGTTATTTGAATGTCTGAATCATTGCTAAGCTCGCCATATTTATTTAAGAGC
TAATTAAATAGATACTCTCTGTGCACAAAGGATTACCTAGGGCAGCGTAAGTGAAGATTG
TGATCAGAGGTCAATATCAATGTGTAAATTTTGCCTTTATCATGTCTGCTTTTCGTTCCT
TAGCTCCTCACTGACTCAATGCCCTCCATGGCTAGGAGCTCTGCTGACATTGTGGAAGCT
GCTGGGCAGACCACTGTGAGTAATGGCTTGAACTATTTTTTCAGGTTTGGCGGTTTGCTT
AGTGGAACTAAATGTGTGACTGCGAAATACAACATGGCATTAAGAATGGGTGCTCCATAC
CAATGAGAGCCACAAACACGAATGGAAGTTGTCAAATTATTTATGAAACTCTGAGGATGA
TTAATTAAGATCAGAACAATTCCCCAGAGATTAGGAGTGAGGTTTTATAGAATTGTTGGA
ATAATAGGTGCTCAAATTATTATTAGCTGATTATTGAACTAATTATCAGACAATAGAAGA
GGAGTGATTGGAAAAAGAAAGAAACAGCCATGATTGAAAATGATCACTGTGAAACATGAG
TCACATGGCTGACTACATGTCTGGAACTTTGAGAACTACTGAAGAAGGAATATAATCCAT
TCTTTTCATTTCAAGTGTTCTTGTAGAAAGACTACAGGACCATATAATAGGTTCATTTTC
CAGTGTTCTTATAAATTCCATTCCATTTTCATAATTGTATCAATAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved