Rattus_norvegicus Locus Mono:120:SNORD43
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:120:SNORD43
Rattus_norvegicus
Mono:120:SNORD43
7
SNORD43
1001..1064
2064
TAAATCTGAAAATTATGAACGGGAACGGCATCTGGGGACTGAAATGGCAGAGACAGGAC
TCGAGGGAGATGTACCCAAAATCATGGCGTATTAAAGGCAAGTCATTGTCAAATCAAAAT
CACTGGTTAGAAAAAAAAAAGCAGTTTCATTCAGCCTTTCTATCTTAAGAGCTCTCAAGA
GCAATACAGTCAGTTGTATCACACTAGGCCTGCTTCAAAACGCCGTTGTTTCGTTGCTGT
GTGGGACCGAAGGGACTAGCACTGTGTGATTCCGTTCTAGAGGTGACGGGAAACACAATG
CCTTCATTTTTCTTCCTCATCAAATTTGGCTGCTGCAGACCGCCGTAGATTCATTACATT
CAAAAGCGTTTCGCTAAGTTTGAACCCAACCACCCTCCGTACAAACGCTATTTGTCAATC
CCGAGGGGGCGGGGAAACGTGTGTAAAATGATGTTCCATTCGTGCCCTTCGACCCGACGT
CCACTGCGGCAGCACGTTCGCACGCTGAGAAGGCGGAGCCATCGAGTGGCTTTATATAGC
CTGCACCAGCGCCTGCTCGATCTCTATCGGCGGCGTGTGGCGGCGAGATGGTATGTACGA
CTGTGATGCTTTCCTCTATAGTCTTCCGCTGGCCTGACTGTATCGGCCTACCATCGGCGC
CATCCCGGCCTCACCAATACTGAGAGGTTATTCTAGGGAGTCAGTGGACGGGCCGCGACC
ATCCCTATATCCAGGGTCCTAAATGGGTTTATAGAAAACGTGTGGGACCGACTTGGGCCT
CTGGGACAGCCATTTGATTGAGCGCAATCCTAAGGGACTCTAGTAGAACTGGCTATTTTG
TGGCCTATTCGAGGTTTGGGCCCATGGTTAGCCTGGTAGGGATGGCCGTGGGCTTTTCAG
GAATGCATTGACTAAACCTGAGACGTTTTGCAACTTTGGTCGAATCCACCTTGGAATGTG
GTTCCAAGAAAGGAAGGAGGATCTCTGGAGTTCCCAGAAGCCACAAATGATGAATCCTTT
GACGGGCGGGCAGAATCTCTGTGCTGATTGTCATGTTCTGATCTGGCTTTGGGAGTTCTA
GAGGCCTACTTGTAATAGGCTGTGCCTTTGTCGGCCATGTTGCCATTTAGTGGTGACTCC
TGAAAATTCACCCAAAGGTAACTTGTTTAGGAGATTTTAGTATCGTCACTTAGTTGTTCG
TTGAAACTCTAGAACTAAAGCATTTAGTATTGTTGCAGTCTATCTTAGGACAAAAGTGGA
GTCCTCTTTTGCTTAATGGTAAGAGATGGGAAAGTCTTCTCACAGCATTGTTAGTGATTC
TCCCGTTTTACCTCAGTCTCACAGGAAATTCTCAGCTCCTAGGCATGGGTCCTTGGGCTT
CTTGCCTCGGAAGCGCAGCAGCCGGCATCGTGGAAAAGTGAAGAGCTTCCCTAAGGATGA
CCCTTCCAAGCCTGTTCACCTCACAGCCTTCCTAGGGTACAAGGCTGGCATGACCCACAT
TGTCCGGGAAGTTGACCGGCCAGGATCTAGTATGTACAAAACTTGTCCAACTTGGGGTTG
TGTGTAATTATGCCTGTAGTTACAGTAAATTTGCAAAGAACAGTAGGTGACCTCCATCCG
ATGGTGCTTTGTGCTAATCTGGAACAAAGGCTCATTTACCTAGGAATCAAACCCAGGTCC
TATGAAAGGATAGACAATATTAGACTCAAGAGATCCCTTGAGGGGCTGGGGATTTAGCTC
AGTGGTAGAGCGCTTACCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAA
AAAGAACCAAAAAAAAGAGATCCCTTGAGCTTTGATTTTTGCCTACTTGCAACTTTTTCT
AGATAGTTAGCAACTGTATGTTTGACAAGTTATGAAGAGACCTGAACTAAGGCCTGTGAC
GAAGCTGCGCTTTGAGACAGTCTGAAATGAAAACACATGGCCTTTTGCTGCTATTACAGC
GCTGGTAGTCAGCACCTGGCGTACTGCCTGCTTTAGATTAGCTGCATTCCTGATGTGTCT
TGGGCTCAACTGTTAGAAGCTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved