Rattus_norvegicus Locus Poly:9:SNORA76
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:9:SNORA76
Rattus_norvegicus
Poly:9:SNORA76
10
SNORA76
1258..1390
2390
GCTCTTAACCGCTGAGCCATCTCTCCTGCCCGTAGAATACAGATCTTAAACTGGGCGTT
TAAGCTTTTCAAGTGCTGGAATTATAGATGAGTCATGAAGCTAGGCCGAGGGAGGATTAT
CTCAAATGGAGGACCAGAAAGGTCCTCATCACCAAATCAGGATTCGTTCACAGATACAGT
CTATGCTCCCACCGCTCCAGAACCTTTGAACCGAAGAAGCACTTCGGCTCATTTTCCCAC
CCTCAGCCTGGCTGCGGGACAGAATATTTCATACACGTCACGCTCTTATTTGTCTGGTTC
AGCTGCTTACTGCTAAGGGACATGCTAATTACAGCCCCCAAACTGAGAGGTAGGGGAAAT
TTTTATTTTCTTTTTAATTTTTAAAAATTTTTCCTGGGGGTTGGGGATTTAGCTCAGCGG
TAGAGCACTTGCCTAGCAAGCGCAAGGCCCTGGGTTCGATCCCCAGCTCCGAAAAAAAGA
GAAAAAAAATTTTCCGGGGGCTGGAGAGATGGCTCAGCGGTTAACAGCACTGACTGCTCT
TCCAGAGGTCCTGAGTTCAATTCCCAGCAAACATAGGGTGGCTCACAACCATCTGTAATG
AGATCTGATTCCCTCTTCTGGTGTGTCTGAAGACAGCTACACTGTACTCATATAAATAAA
AATTAATAAAAAAATTAAAATAAATTTTTTTTTTCCGGAAAACGCAAGGAGCACGCAACT
CACAAACAGCTGGTTTCTTTCCAGCTCCAAGGTTGGAGGACCTATCTACACGTTGGAGGA
CTCAGAAAGTACGACTCAATGAGCCTGTCGCTCTTGAACCCGTGACAAGAAAACTGGCTT
CCTATTGGTCAATATTACAGAGGCCCGCCCAGCAACTTCCGGACGCTTTCTTTAAGTTAA
AGCCACACGGCGGTTCCGGTCTCTTAGCCACGGGGATAGCTCTAAGGTAATGTGCTCTTT
GCTTGGGCAGAGGGGCTGCATGGTTTGTGGGTGAGCGGCCGGCCATGATGACACTCCATA
CAAAGCACGCGTTAGACTGCTGATCCGGGTGATGCGAATCGGAGTCTGAGCCGACTGCGG
CAGCGGGAGGTGGCGGGCCCAGCCAAATTCCGCACCCTCACCCTTCGCTTCTCTTTCAGG
TCTGCCCTGCGCAGGACAGCAGATAGCGTGAGCTTCTACATACAACCTTTCCCCCAAGCC
TCTGAATAAAGTGCTTCAACAACATTGCTGGTGTCTTGTGTGTGTCACTGTCGCCGACGC
GCTGCCTTTGAGCCCCCGGCGCACCTTCTCGTGGTGCCGGGGGTTAAGCTGCAGCGCTAT
AGCATTTTGCTGGCGCATAACTGGGGCCGCCTGCCTATCGCGGGCGGCCCTTTTAACCGC
TAGCTACAGGCTAAAACCAGCTTACTACATGGTGCTTTGGGAGTCGAGAACAGATGGTAT
TCCCAGGTCTTGAGAGGCCCAGGCCTGAAAGTAACTATGACCCTAGTGATTCTTGCTCAA
GTAGGTCTATCCTTTGTCCTAATCCCAGGTGTGGGCGATAGTTGAGGTGTGTCCGTCTAC
GGTAAATTGGAATGGGGGAATCCTGGACGTGTATCAATGCCATCTGTGGCACACAGAAGG
TTGGACTGAAGCCTTAGTGGCGGCGGGGGAGGTTGGTAATGTAATCAGGCCTCCTAAGAG
GAGTCGAAGGACTCTAGGCATCAGAGTGCTTGGATAGATTTACCAGAGGTTGGGCCTACA
GCACTGGGTAGAGCCAACTACCACGCACTCACACGTCCATTAAGCAAATCTTGTCTGAAT
AACCGAGACAAACTGACCTAGAAATTTTGACTTAGAGACTTCTTAACGTTCCTAACACCA
AGAAAATAGGCTTTAGAGCAAAGTTGCTTACTTGGAGCTTGCTAGTAAGCAGTTACAGAG
TAGTTAACAAAGATGAAACCTTCCATTTGGATTGAACAAAAGTCAAGATAAAGTTTGTTT
CCTAAAAAAACAGGATTAATCCCGCGGTGTTTAAGTTAGGCGAGGCAACAATGGATTGCT
TTAGTTGCATTCCCACCTCGACATTGCTGAAGGCTAGCAGGGGTGGCTAAAACTAGCCTG
CTGAGTGAATTCACAGTCCTTTGGCCTTCTCTAAAAAATGACATGCTTGTCTGGTGTTTG
AGAATTTATTTTGTGAGATGAGCTCGGCGGGGTGCAGTCTTGGAATCTTCAATTGTGGAT
CTATCTAGTCTTGCCTTTAGTAACTGCAGAGAGAGACCACTGAACAAGATGTGGATTCCT
GACAGGCAATTGGGAGAAAGTAAAGCAGTACACTGACTGGAATGGTCAAATAATTTGTCA
TGTTTTAATGGGATGATTAAAATAAAGGCTCAAATAAGTTTTCAATATATT
  Untranslated Region
  Coding Sequence
  snoRNA
AC_000078.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved