Rattus_norvegicus Locus Mono:472:SNORA70
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:472:SNORA70
Rattus_norvegicus
Mono:472:SNORA70
15
SNORA70
1001..1135
2135
AGATGTGGCTTTGAGGAGGAAGTTTGTCACTGTAGCCTTGTGCTTTAAGACCCTCCCCC
TAACCACATGAAGCCAGGCTTCTACTAGCTAGCTGCCTTCTGAACAAGAGATGAGACTCT
CAACTCCTCCTACACTATGCCTCCTGGATGCTGCCATACTCCTGCCTTGATACTAATGGA
CTGAGCCTCTAAACCTGTAAGCCAGCCCCCATTATAGGTTGTCCTTATAAGAGTTGCCAT
GGTCATGGTGTCTGTTCAAAGCAGCAAAAGCCTAAGATACGACTCAATTTGATAAAAACA
TCGTCTTTACCTGTGACTTGTCTTCATCATGAGCTCTGATTGTCAGCCTTTCACAGTGCC
TTGAGGCACACAGTATCTATCCCTTGCTATTGTTGAATGTGTTGTGTGATGGTGGAGCCA
AGAGAATCACAGGCACTCTGGGAGCAGCGATGGGATGGAGTTCTTGTTCTATAAAGACAG
CGAGATATTACAGACCTAAGAATATAAATGAAGAAAGGAAACAGAGATGGAGTCTGCAAC
AGAGGACACAAGCTGAAGTTACAGTCAAGAATGCACAAGGATTTTGTATTCTTAAGCGGC
TTGAGAACACACAAGTTTAGGTGTTTGTAATTTAAAAAGAGCAATGAGTAGGTAGGTCAA
TCTTTCTGTTTTCCCAAAAGTTGAGTAGCGTATCTTAAGAAAAATTTTAATATATATTAG
TATAAACGTGGAACTGGAGCGATGACTCAGTCATAAAGCACACATACTGCTTTTCCAGAG
GTGCCAGGGTTGGATTTTCAGCTGGCAACTGTCCCTAACAGCAGTGCTAGGGGATCCAAC
ACCCTCCTCAGTCTCTGTGAATATATCAATGTGGTGATAAACAAGCCACATGAAAAACTG
CTTTGTGATATTATCATGTCTAAATAAATATACCAGTGATTCTCAACCTATGAGTTTCAA
CTCCATTGGGAGGCACATATCTGACATACTGCATATCAGCTATTCACATTATAAGTCATC
ACAGTCCCTTTCCCCATGGGGACTTTGGTGTGCAATGGTTGCAAACAGCAGCCTCCTTGG
TAGTGTATGTAGCCTATTGTCTATATGGGTTACCTCAAGGGACCTTGGAAACAGTTTTCT
GGCAGTTGAATAATCAAGTGTCTGATCATAATTGCTGTCCCTGATCTAGGCTCCAGACAG
GTATGCGTGGTGCCTTTGGGAAGCCCCAGGGCACAGTAGCCAGGGTTCACATTGGCCAAG
TCATCATGTCTATCCGAACCAAGCTGCAGAATAAGGAACATGTGATTGAGGCTCTGCGCA
GGGCCAAGTTCAAGTTCCCTGGCTGCCAGAAGATCCACATCTCAAAGAAATGGGGTTTCA
CCAAGTTCAATGCAGATGAATTTGAAGACATGGTTGCTGAGAAGCGGCTCATTCCTGATG
GCTGTGGTGTCAAATATATCCCCAATCGTGGTCCTCCTGACAAGTGGAGAGCCCTGCATT
CCAGAAGGCTTCCACAGTGCTCTCCTATACCCTATCAAATCATGTTCAATAATAAATCTC
ACATCAAATCTGAAAAAAAAAGTCATCACAGTAGCAAAATTATGCTTCTGATGTAGCAGT
GAAACAGTTTTGTGGTTGCAGCTCACCACAGCATACATAAAGAATTGTTAAACTTAAGAA
GACTATACATGGAATGAGGCCTGAGAGAAAGATAAGTCAGTGACGGTCTACAACACTAGC
ACCATGCCCAGGATTCTATCGCCAACAACAGCTCCTGAGAAGGTTTAAGGCTGTGTTACT
TAGCATTGAAAGAAAACTCCCTTTGCTTTGTATGAGCTGTGCTTTCATTTCTATATTACT
ACAGCACCCAGAACAAAGCAGGAAATGTATTTGGAGAAGTGATGAGCTTCTCCATTAGAT
GCTAGGCTTATGGATTCACACGAGGGTTAGAAATAGATACATCTCACCCGTCAGAGTTTG
TGTTGATATGCAATGTAAGCTATCAAATTGCTAAACACCTAAGAGCTGCAAACAGAGAAA
TAGCTGAACAAATTATGGTACATTTTCTGATGTTCTGTGTCTCTCAGTTTTAGAGGGTAA
CTTATCTATATAAACTGGCATGCACACACTGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved