Rattus_norvegicus Locus Mono:312:SNORA32
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:312:SNORA32
Rattus_norvegicus
Mono:312:SNORA32
2
SNORA32
1001..1101
2101
AAATGAGACCATATCCACATAGTTATATGATACTGATTTAATAGGGAAGTAAGCATTCT
GTAGGCAGAATACACTAAATTATTTCTTTTTTATCTTAATGTATAACAAAAAGTTGTCTA
TGTGCACGCATCCATCTACAGCAATCCTTCCATAGTGCAGAGAGAGAAAATGATCAAAAT
CTCTTCGACAGCCACAGGAAGCAGTGTTGTGGATGCAGAGTTGTCAGGATGGTCTCAATG
TTGTCCCAGTTCCCCATTCTCTCCAAGCAGTCTTACTTGCAGATCATGTCTCAAGGACCT
TTAATGTTAATTGTTACAGATTGCATTGACAAAGCATTTTGCAGTTAATACAGTATACAT
GTTCATTTTCCTTTTCTTCTTTTTTCTTTTCTCTTTTTCTTTTGTTTTTCCAATGGAATT
GAGCTACATTTAGTAAAAGTTTTTCTTTCAGCCTAGGACACACACCTAAGAAATGTTTGT
CTTGATGATTTAACACTACTAACCCTAACCCTGAAATGTACAAGCTTCTACTTCAAAACA
GCTTTCAGCACTGACTGTTGACGGCGAATGTAAAGCTCTGCACAGTAAAAACAAGTGCTT
CAGTCACGTCAGTGTGAAAATATCTTATAAGTTGGCATTCACGCTCTCTGTCTGTGAGAT
GAATGTGAAACATAAATGAATTCTGTGTTTAGATCCAAGTTCTCTCACTTGTATCTCCTT
TTGCATAACCCTCATCCCAAAATATCCCATCTGAAACTCTCCCTTTCTCATGTAGTCCTA
ATAAGGAATTCATAGTCCGTAGTAGAAAAAAAATCAACTATAATATTCTGAGTTTCTCCC
TAAGTAAGAATAATGCTTCACCACTCTGAAAGTTTGGGGTTTGCCATGTAATTAGAAACA
GTGACATGTGAAGGCTACATGACATTTCTGAGCTGTAACTGCAAACTTGATTGTTATTGG
AATAAAAAGCAAACATGATTAGTCCTCTGTAAGGTCCAAGGAGTAGAATTATTTGGAATA
GTTCAGTTTTTAAAAGCGATGATCATTCCCATTAGGTTTTCCATATGCTACTTGAGTAGC
ACTTAACCTGTTGGGAACATTTTTTGAGCAAATCTTTATCCAGTTGTTACTTTATATGTA
GATGGTTCTAGAATACTGACTACTCATCCCATTACTCCCATGTTCTTATTATGCAGGGCT
AAAAAGCACAACTGGATGCCCTTGAGAAAGGGCTATTTTCAGAGTGCCTGGACGGAAAGC
AAAGAAATCAAACGAACCACTTAAATAAAAATTTATTGACAATAAATAATTTTATACATT
AAAAAAGAACCCTTAACACACACACACAAAAGCGATGATCAGTACTTTTTACATTCCTCT
TGTTTACTGCCCAAACAGGTATGATAGAAAATCATATGAAATTGCTCATTCGAAGAAAAT
AATCATAAATACTAAATATCCTTCCATTATTTTCCTACAAAATGTGTATGCTGTTTCACC
ACCATGAGAGAAATCACCAGATAATTTTCACAAATATGTAATACTTTCTCATTCTTGCTC
ATTTACAAAGTTAAATGAAATTGTACCTGCTGGAATTTTAAAATAATTTCTTTTTACTTA
TGTTTCTGTATCTAGTTTGATTTGCCATGTGCATATGTGTGCCAACCAAGACCAGATGAA
AGTATAAAATTCATTGTAGCTGGAGTTACAAGTAGTCATATTCTGCCTTTTGAGAGGATA
CTAGGACTCTGGTCATCTAGAATGTGACCATGTGCTTTTGACCACTGAGCCATTTTGCTA
AGCCATTTGTGATGCAGTTTTACAGATAGTGCTTTTGCGAATTTCACAATCTAATTCTCA
AGTTTGTATTTGAGTTCCTTATATGCATTTCTTTAAAGTAGTACTGTTCACTCACTACTT
TTTAAAAAAAATTACAGCTTATGTTATGGGAATCGGTTGTGGTAGCCATTGACATTCAGG
GCAAATTATTATAAGAAATCATTAGAAGAATCCTTTGTGTGCCTTGTATCCTTTGTATTG
TTCTTGAAATGTCCTTGGCTGAGATTGTATCCACAAAATTGATTTTGTTTTAGTGCTCAT
GT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved