Rattus_norvegicus Locus Mono:200:SNORA3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:200:SNORA3
Rattus_norvegicus
Mono:200:SNORA3
4
SNORA3
1001..1122
2122
TATGTTGAGCAGGAGGCAAGTGAGAAATATAAAATTGTAGTCTAGACAGAGTGTGAATT
TGTCTCCTGTCCTAGTCTCCTAAGTAGCTAGAATTATAAGCTTATGTCACCAGGCCCAGC
TCTGTTACCACCTCTTGAATTTCAGTGTATTTTAAGATTTTGTGGTCCCCAACAGCCTGA
TCATACCAATATCCCTTTATTGTTTACTGATACATACTAACCAAATATTTAATAGCACAC
ATTCAGCTTCCAGTCAAACATTTTAACAAGTACTTGAGTACCTATTTCAAGTAAAGCACA
GAGCTATATAATAGGTAAATGAATTTTTTGATGGTCTCAGAGATCTCACTTTTTATGAGG
TATAAAGTGAAAATAACTTAAAGGTAGTTAAATACACTAGGTTATAGATATCAAGGTGGT
GAGTGTGCTGGCTACTTTACACTATATTATTCTGTTGAGTGAATAATCATAATCTTGGCA
GTAGTTATAACCTGTTTATAGTTGAAGTAATTTATCCAAGTCTATATGAATGACAGAGCA
GTATCAACATTTCAACACGTCAATAAAATAGGTCAGTTATCACTACTATGTACTGTAAGG
TTAAAAAAGGAAGAGCAGAAAAATAACTCTTAGCCAGTTGAGCGTGTTTTGTTTTATTTC
TTTCTGGTAAGTTCTATGCAATGACTGTGCCCATTTTTATTGTCTGGGTTTTAGTAAATG
AATCTGATCTCTTCCATATAGCCATAAGGATCAATAGTCATAAGAAGTTTCTTTCTTCTC
AGCCATATTCTGTGTTTTGATATGACATTGGTACATTAGTACTTGGAAAGTCAGCACACG
GGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGCAAGCACAAGGCCCTGGGTTC
AGTCCCCAGCTCCGGGGGGGGGGTGGGGAAAGGAAAGTCAGCATACAGGATCTAAACCAA
CTAATAAAATATTCCATCAAAATTTCACCCTTGCTATTTCACTAGAGTCACAGCCTGGTA
CAGCATATGTCCTGGTGAATAGAATTCTCTGAGAGAATCTGCTGGTCTTGGTACACTGGA
AGGGACACCCAGTGCCTTGTTAGTGACCAGTGCAGAAAAATGTCCTACTTCACCTATCAG
TGCATACTTACTTTCTTCTAAATCCTTTAAAAATAAAATAAATTTACTCTCAGTTGTGGA
GTTTAGTCATGGCTTCAGTTTTGTCTCTCACAGATGATCTTACCGAATAGTTTGTAACTC
CTCCTGACTCCTCCTGGGGTGATCTTTTTAACCCAGATTTTACAGCCTGACATGCCTAAA
ATAAGGTGTTTTCTAGATGACCACAGAATGCGGAAGAAAAAGTTTGTATGAGTATTACAA
ACAGTTGAGCAGAAGCCCACAAGTTCGGGTGACCTAAGAATGCAATGAAGTTAGTGATTG
GTCATCGACACATTTGAGCTCTTCATCCAATAATAGTAGAACATCTTGGAAATTCATTGA
GAGACAAGAGCTTTCCAGTGGCGATAGTCTTATCTATTGGAGTTCCTCAGTTGGAAATGA
GACTTAGTAAAGAATCTCTGGGACCAGAACTGAGTGCTTTCTTTGCTAACTGGGAAGCAC
TTATGAACAGGGAACTGAAAGAACAAGATGCTGCATCGGAAAGACAGAAACAGAATATAA
GTAAGGCCCTTGAGCAGCATCCCCGGAGCCCCTCTTGCCCATACCCAGCCATAAATGTGA
CGACTCTGTGAAAACTCTCCTTCTGTGGCACTCAGTGCTTTTTATACCATAACCTCACAA
CACCAAGAAAGCGTGAGCTTACAAACTAGCCTGACTCTGGATGCCCAGAGAGGGGAATTC
TGATTCTCTGGCTTACCCAACATTCCATCCAAGCTGTCAAGACTGGGAAGTGAAGTCTAT
CTAAGAAATGCTTTTTCTTAAAACATTTTCAATGCTTCCCTCTCCTTTGTGTCAGAAGGG
TATAAGTCAAGAAATTAGCCACCATCTCAAAAGTAAATTGTGTTACCATTTACATATTCC
CTGGCAGTCCCCCTTCCCCCCCGCCACCCATGGGTCAGTAAATCTATTTAGTAAATTTTG
AGGTCAATAAATTTTTTTAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved