Rattus_norvegicus Locus Mono:42:SNORA51
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:42:SNORA51
Rattus_norvegicus
Mono:42:SNORA51
9
SNORA51
1001..1119
2119
CTCTCAGATGCTGCTCTGCAGACCTTGCATGGGAAAATTGCTAAAGTCCACAAAGAGCC
CTTTCCCATAATTCCCAGGGAAGAAGCTCTGGTAAGAATTGAGTTCACCTGCAAGGTCAC
TAGCCTGTAAATTTACCCTGATTCCCAAACTTCGTGTCCTCCAACCTCTGGGGCCCAGGG
CTAGCAAATCAAGAGACATAAACTCAACAAAAGGAGATTGCTTGGGAGAGAAAGGGCTTT
GCATGATTGGTGAACAGAGAAATGCATTGGGAATGTGGAAGGCTAGGCCTGGAGACATTG
CTGGTGCCCCACAGGAAGGGAAGGGAGATTCAGAAGGAAGCTGCCATTGAATGTCCTCCT
CCACTAATGTCTTGACCCAGGGCTGTGACCTGAGGGTGGGGCTAGGCAGCGGAGCTGAGA
ATCTTCCCTGCTCTGGCTCTGCCCTTCCTAGACTGCCACGGGAGAAGGAAAGGATGAAAA
TGTCACTGTCACACCCACCGGAGTGCCTGAGAAAGAGCAGGAAAGGAACTCCGGGTTTCA
TGTCACACAATGCACAGCCAAATTACCCAGAGGTGAGAAAGGCAGAGACAGCACGGGGCT
GAAGGGTGAACATTCCGCGACTGTGCCTACCACTGGGGAATCCACGCCAGCTTCTGTTAA
GATGAGGAAGGCTGTAGCCGAAGACATCAGGTTGGAATGTGGCAGCCCCCCCTTCTTTGT
CAGCACTGTCCCCATGTACCCAGTGTTCGGAGATCACTAGCGATCTGCTCTGCTAGCTTG
GCTCCCAGGTTAAGCCTGCTGGGCACCGTACATCCAGCGATGACCATAAATTCCCCGCGG
ATTCACAGGGATCGGAACGTCATTGGGCTATACATGGATCTAATCTAATTTGATCATTTT
TATGTCTCCTGGCACAAGCTGATGTTCTATGGACTGGTGTGCCAAGCACTAACAACAAAG
ACACAAGTGTATACGTGTGTGAGGTAAAAGTGTATTGTTGGGGCCTCCTTGTGCTTGCCA
CAGGCTGTGTTCCTACCCTGACTGTATAGAAAGAAGAGGCAGAATAAACCTACAGCCTAG
GCCACTGTGCCTGGTCTGTAGGGTGAATAGGGAGACGGGGCGGGAAGGACGCTCTTACCA
CAGTGGCTGAATGTTTGGCGTGGGAGGCAGTAAAGGGCTGAGAAGATGCACCTGCATAGG
CGGCAGCTGTGCAGGGTCCAAGCTCCGTGCCCCAGTGCGCCACAGTCTCTGCAGGGGCCA
GAACAGGTCAGTGTTGTCAGTTTGCCCCTCCCTCCCAAGCCAGTCCCCGCCCAGCCTACT
TTTACCCCACCCACCTGTGTCTCTGGTCGTGCTCGCAGTAGCGACCTGTGAAGTGCGCGG
GGCACACGCAGAAACTGCCCAGAACGCAGGTGCCTCCATTGTGGCAACAGCGGGATCCAG
GGACCGCACCTGCAGGATGACCCGGGTCAGCAGCTGTGTTAGCCTCCGGTGGCGCTTGGC
AAGTCCCCTCCCGCAGAGGGGCAGGGCTTGGGAGGGGACCGTGCCTGCTGAGTGTTTGCT
AGGTAAACCCCACTCTTCAGTTGATGAAAGCTAGAAAACAAGGTAGCAGGAATGTGGGCG
GGGTCCCGGCGGGGACAGCCCTTGATACCCTCCAAGTTGCTTCTCTCCCTCTCTCTTCCA
CTGTTAAAGTCAGCATGTGACTTTGTGGACAGTGATTAACCACAGGCCTCCCAGGCAGGA
CCACCCAAGGGTGTGATGTCGCTAGCCGGGCCTAGAGCCACTGAGTTTGCTGGAGTTGCC
CGAAAGCTAGGCGGCAGCATTTATCTTATTTACAGAGCAAAAGTTGCTGGGTTTACCCAT
GAAAAAGGGAATGAGACTTCAGAGTAAACTTCCTTCTTTTTTTAACTTGAGGTGAAAAGA
CGCCCCTGTCCGTGTCTCCCTTCCAGCCCGGGTGCTCGGGATCCACTGCCGAGGATGCGT
AGCGTAGAGCTAAGACTTACTCTCCTCCAAAGTGTTGGAACCAGAAAGGGCCTCCGACGG
GTGCGCTCCCTCCTGGCTGTCATTCTTTCTACTGGAACTACTCAGGGTTCCATCCAGTGT
CGTCCCTGGGAGCTTTGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved