Rattus_norvegicus Locus Mono:142:SNORA67
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:142:SNORA67
Rattus_norvegicus
Mono:142:SNORA67
6
SNORA67
1001..1120
2120
ACTTCTCTAGACCCAGCCGATATTATTGTTATTCCCATCTGTAAAGGAGAAAACTGAAA
TGGAGCCAAGATGTCAGTTTGCTTCTAATAAATAGTTTGGTAACCACATCCTACTAAATG
ATCTTCATATAATAACAAAGATGAAAATGTAGTTTAATTAAATTTAACTTATTCCTCCAA
ATACTTACTGAGTATTGCTATTGGTCAAGTACCATTTTGAGTTCTAGAACATATGCCTTC
TGATAACCCCATTGTCATACATGTTGATTTTAGTAGTTTGCAAATCTATTCTAACCAAGG
GATAGACACATCATAAAGGCTCTTCTAACCATGGTAGCCCTTGTTTTATGACCAGAAACC
AGAGCATGTAGAGCAGTGGGAACAATCAGGATTCATGTCATAAAGAGATGCTGGGACAAA
GACAGTCTCCTTCCTTAGATTTCTATGGAAATAAATGGTTGATTAGAGGTGGGATGACTT
CTGAGGTGTCAGCAACCACAGTCTGCAGAGGATCCTCGACTGCAGGACAGAGGATAAGGC
TAGGACACTAGAGAAGGAGATAGAGGCAGGGAGAAGCAGCCCATAAATGCCATAAGAGTG
AGTCAAAGTTAAAGTCCCAGGATGTTCCAGGTAAGTTAATAGATTACATTTTCTTTTGAA
CTTGGACTCTTTTCCAACAGCAAAAATAGACCCCAAGAGGATCTGTCCATGCTTCCAGGG
CAAAGGACAAAATTATAATGTGCTTGGTTATAGATAAAGCATTCATCAAGGTAATCATTC
ATTTTATCTTGAAAACTGTTCAAGCTAGACGTCAATCATAGTCTAGAAAAAGTACAAAGA
GCTCCATACTCGCTCTTAACCTAACATAACACCAAACAAAACTCTAAGTTAGAACAATAC
AGGAAGGAGTGTGATTACTGTTCCCATGAAAAGCGAGGCAACATGACTGTAAGGTAGGGA
TGTGTGTGGTGTAGTAAACAAGAGGAATACAGACAGTTTATAATCAGGAAGATGTAGCTA
AGCTAAGAGCAAGCCATCTGGTATAACACTTTACATGTGTTAAAGAAACAGGTTCAAAAG
GAATACTTGTTTCCTTTGCCCTCCTTTGGCAGCCTACATATATGCTTACTAAATTAGGGT
TGATAGTGTCCTCTGATGGCTTTATTCTTTCTTGACCTGTTGGCCAGAGGCATTGATGTG
CAGCAGGTCTCCTTAGTCATCAATTATGACCTTCCCACCAACAGGGAAAACTACGTCCAC
AGAATTGGTCGAGGTGGTCGGTTTGGCCGGAAAGGTGTGGCTAGTAACATGGTGACAGAA
GAAGACAAGAGGACTCTTCGAGACATTGAGACTTTCTACAACACCTCCATTGAAGAGATG
CCCCTCAACGTTGCTGACCTCATTTGAGGGGCTGTCCTGCTACCTGGCCCTAGCCCAGGG
TTCAGTCCTGGGGGCGGGGCTGAGGAACAGCTGGAGGGGGGAGGGAAGGGAGCCAAGGGA
TGGACATCTTGTTTTTGTTTTTTTGTTTTGTTTTTTTTTCTCTCTCTCTCTCTCTTTGAA
TAAATGTCACTTTTTGAGGCAAAAAAAAAAAAAAGAAACAGGTTCAAAATGCAAAGCAGC
ATAGTTTAAATGTAAGTAATTTATAGTCATGTAACTGCCCTAGGAAAAAGTATTTTGGGG
GGAGGGGGAATGACTCCAGACTTCTGTCCTTCTGTCGGTGGAAAGATGACTGTAAAAAGA
CGCAGTTCTAAAGGGTTAGGGGTGCTAAGCAGACCTACATTTTTTAGCCATAACTTCATA
CTTGTGATTCTTCACACTACAGATTTTGTCTAAATGATAATAGTAACCCAGTATATTTTA
TGAACCAAAGCTTATTTTTTTTTTTGAGATAGCAGGGCTGTTTTCAAAAAACTACACAGG
CTAATGATGGATTTGTTCAATTTCACCCTTTGACTTACTCACTGGAAGATGTTCTGATAG
TTCACATTTCTATTTTTGCCATTTCTTTTGTTGAAAATAGATTATTTTCATGTAATCTGA
TTATGCTTGCCCTATCCCAACTCCTCCAAGGTCATCCACACCTCCCCTCTCATTCGGTTT
CACCCTTCCTATCTCATTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved