Rattus_norvegicus Locus Poly:18:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:18:SNORD115
Rattus_norvegicus
Poly:18:SNORD115
1
SNORD115, SNORD115, SNORD115
1001..1078, 2836..2913, 4668..4745
5745
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGAA
CTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCA
AATTCAAGCTAGGTCTACCCTTCTTCCACACAAGAGCGCTGTGCCCTTGTACCCTCTGCA
CTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCTAGGTAAGCCATGGTGCA
GGGGAAATTACTTTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAT
TAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCA
ACCAGGGAGCCAGGTTTACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAACTGTGCTGGCAAACACTGCCTCCCAATTAGCACCTAGTCTCGTAATCTGCTTGTG
TGCAAGTCTGCAACACCTACCCCGTCATCATTACCCTCTCTGCTCTTATGTCTTGCAGTC
ACCTGGCATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTACAGCCC
ATAAAAGGTTTCTAATTAAAAATAATGCAATACCAGTCAGAAATGAATTTCACTTCTCAG
TATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTCTACCTGTA
GTTCAAACACTCATAAAATTGAATTTCTTGTAAGAGATCCTAGATGATACTCTCTACACA
AATGGAGGGATCTGGAATATGAATATACCTTTTGAGTTTGGAAAAATTTCAGTCCACACA
CAGGCTCACAAATCAAAGCTCGTGCACAGAGATGGATTTCCAATGGCAAGGGGAACCCAG
GAATAAGACTTTAGTTTAGAGATGAAGAAATTGGGAATAAATTTTCAACATCAAAAGACA
CTCCAAGAATTATTGCCCCAAAGAGAGCTTCGCGAAATTTTTCAAGAAACTCTCAGGCCA
CAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGCAGGTGTGGCTTGGCTACCTATTTAC
TTCCATGAGTCATCACACTGCTTCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCAT
CAGAAAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAGGAACGTGAT
GTCAATGGGATACTTGCAACACCAACTGATCTAGTTACACGAATTTTGGTCACATTCTGA
GTTTCATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACATG
TTGCTTTCTTCTGGGCAACAGATTCTCTTCAGCATTCACATACCAGCTGTGGGAACTGAT
TGTTTCCATGCAGTATGGAAATGGGGAGGAATGAACATTGCCTAACGCATAAATCTGAAA
TGCACAAGTCTCATGAAAATTTGATTATAGTATATGTAACTTTTCGTGTATTGTCCTTCC
AATATTACTCAGGTAAATTCACCTTTGCCTTGTTTTCTGACAATGTTTACAAATTGAAAG
ATTTGATCGGTGTATATGATCAAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTTTT
GGGTACCTATTGACCTAGTGATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCA
GCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTAAGTGGCATCATACATTAGACTTCTT
AAACAGCCTCCTTAAAATTAATATGATTGTATGAACTGAAGGGATACAATTGCCCTCACA
TCTTGTTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGTCTACCCTTATT
CCACACAAGAGCGCTGTGCCCTTGTACCCTCTGCACTTGCAAGTTTGGATTCAAATTCTG
AGACAGTGTTGGCAGCCCAGGTAAGCCACGGTGCAGGTGAAATTACATTATTGACAGTTG
TGTCCTGCCTGTGTCTGGGTCAATGATGACAACCGAAAGTCAAGAACAGAATGATGACAT
AAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGGTTACAAGCAC
TACTTAGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGACCTTGTG
CTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACTGCC
TGCCAACTAGCACCTAATCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCTGT
CATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCAGGCATCACCCTTGAGGTCCAG
TGGATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAACTTCCTATAAG
ATATTCCTCAGTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTTAATTAAAAATA
ATGCAATCCCAGTCAGAAATGAATTTCACTTCTCAGTATGTTTTGTCCCTTTGAACTGCA
CTATTAAAAATGTAGAGAAATTCCTTTCTACCTGTACTTCATACAGCCATAAAATTGAAT
ATCTTGGTAGAGATCCTAGATGATAATATCTACATAAATGGAGGGATCTGGAATATGAAT
ATACCTTTTGAATTTGGAGAAATTTCAGTCCACACACAGGCTCACATTTCAAAGCACAGA
GATGGATTTCCAATGGCAAGGGGAACCCAGGAATAAGACTATAGTTTAGAGATGTAGAAA
TTGGCGACAAAGTTTCTGCATCAAAAGACACTCCAAGAATTATTCCCCCAAAGAGAGCTT
GGCGAAATTCTTCACGTAACTCTCAGGCCACAGGGAACCTAGCCAGTAGGGGACATTGAA
GTTGCAGGTGTGGCTTGGCTACCTATTCACTTCCATGAGTCATCACACTGCTTCATCCTT
GATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTT
TCTGGAGATCTTGGGACAGAGGAACATGATGTCAATGGGATACTTGCAAACACCAACTGA
TCTAGTCACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTGCT
AATGCTCAGGGATTCATGGTTAAAATACTTGTTGCTTTCCTCTGGGCAACAGATTCTCTT
CAGCATTCACATACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAAG
AATGAACATAGCCTAGCACATAAAGTCTGAAATGCACAAGTCTCATGAAAATTTGATTAA
AGTATACGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGC
CTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGATCAAGAGCA
TGTGTCATCCACTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTA
GGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGAT
TCTGCTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATT
GTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACA
GTCTTCAAATTCAAGTTAGGTCTACCCTTATTCTACACAAGAGCGCTGTGCCCTTGTACC
CTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCA
CGGTGCAGGTGAAATTACATTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATG
ACAACATTAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTTTGCTG
AGGCCCAACCGGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCG
GCACTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACA
ATCTTAGTGCAACTATGCTGGCTAACACTGCCTGCCAACTAGCACCTAATCTCATAATCT
GCTTGTGTGCAAGTTTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCT
TGCAGTCACCAGGCATCACTCTTGAGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAAT
GATCACGATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACGAATAATT
TCAGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCA
CTTCTCAGTATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTC
TTTTTTTTTTTTTTTTTTTTATTAACTTGAGTATTTCTTATATACATTTCGAGTTTTATT
CCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
NW_001084908
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved