Rattus_norvegicus Locus Mono:379:SNORD43
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:379:SNORD43
Rattus_norvegicus
Mono:379:SNORD43
19
SNORD43
1001..1061
2061
CATCCATCCATCATTCATTCATCCATCCATCATCCATCCATTCATCATCCATTCATTCA
TCCATCATTCATTCACTGACCATTATCAAGTGGGTGAAAAGATAGTTCAGGGAACAGGAG
AAACTCTGTCCCTCTGTGTGCTAAGTGTCTGTGTAGGACAGGTGAAGAACTGCAGCTCAG
CCAGGCAGACCAGTTTAAAGGATGTGGTGTCCTCAGACTACTTTACTAGTCTGTGTGGGA
CCCTGGGTTTGATCTCTAGTAGCACAAAAGACAGCTGGGATGGGCAGGCTGGGGTAGGGA
GAAATTCTAATAGATATTTCTCTAAATGATCCATCATCACAAAGAAAAAAAAAAACCTCA
AATGACAACATTAAAACAGAACTTCATACCCTAGAATGGCTACAATCAGAAAAGATAGTG
TTGTGGGACCCTCTGAATTCTCTCTACCGCAGGCAGACTATAATACGGCAGAGCCAGCAT
GTGAAAACATTTTGAAAAACTGTATTATTATCCACTAGTCCACTCTTGTGTATGCCGAGG
AAAAACAGTGACCCAGGGCTCCACAAAACCTATATTCAAAAAAGGTCAGAGCAATGTTAC
AATAGCCAAACAGCAGAAGCAAGCAAATGTCTACCAGTGGCAGAAGGAATTACAGAGATG
ATGTATGCTGTTCAATGTCAGGAGCCATCTAGGACAGGCTAAAGGCCAGCGGGTGGGCTT
TCTGAGATGGTTTCACTGTGGATTGTGACCTTTGCCTCTTGTAGCAAGGCCCAGGGGGAC
AAATCTCAGGGTTTGATTCCTGCAGCTGATATGCCTTTCCTGTCCTTATAAAATTGATAT
GATCCCCCCGCTGGGCATTAGCCCACCCTATTGGGCAGACTTCAGCCCAGCAAAGATGGA
CTGAGTTGAAGTGATGCTACACAAACAAGTAGATGACTTCCTAACTCCTAGTGATGACTC
TGTAAGAATTCCCAAAACTACACTAGTAATAATTAGGGCTTCACAAATGATGAACCCTTT
GATGGGTGGGCAGAAACATGCTGATTGTCATGTTCTGATTTGGAAAGAGGGGGGGAGGGG
GAGGGAGGGAGGAAAAGGAAAAAATGAAAAGAAAAAAAAAAAGAAAAAAGGAAAAAAGAG
AAAAAAGGAAAAAAGAAAATAAAAGGGGTTGGGGATTTAGCTCAGTGGTAGAGTGCTTGC
CTAGGAAGCCCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAAAAGACCCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAGAAAATAAAATAATTAGGGGTTCAACTAGAGCTCTTTCCTA
TATAAAAACTGTAATTGGAATTCTTCCAGGCCTCACCTGACACAACTTAATTGCTTCTGA
GATAGAGAGCAGGAACTGCTAAGACTTACAACTTAGGAACACCTTCCTTACGTTGGAAAA
CAATTAACCAAAGGTCATGAAAGGGAATGAGCAGTTTTCTGTAGGTATAAGGACAGAAGA
TAAAATTCTGACTGGGTTTATCTATACAAAGCCTCATTGTTAACGTATACTAACTTCCAA
TGAACCCGTGGAGCTAGAGAGAGGAAATGAATGTCTAGTCAGATAACTAGTTTTAATGGA
AAGACATGCAAACATCTCTGTCATGAATGTCTTATTCACATTATGACTTGAATTTGTTTA
AACTTGCATTAAGTTTTGAATAGATACCATGCGATCTATTCTCCTAAAAGGTACAAAAAA
CTAGAAACGATGACATTAGGTGGCAGGGGGAGAGAACAGAATTAGGAGGAAGGAGAGAGC
AGTACTCGCTGCAGAGAGGAAGACAAAGAAGTCACTGCAGAGAGAGCAGGACGAGCAGGC
GGCCTTCTCCTCACCATGGGATGGAACAGGTTTTCTCTTAACAAGGCAGGCTTAGTCTTA
CTAAAGAGGACAAAGCTTCCTTACAGACTTGGGTTTAATTCATTTAGCAATAAAAGGGTA
GAAGCCTTTTCTTTATGCAACAAAGGTTGAAGCTTAGTTTTCATCCAGCATGAATGAGTT
CTTTCTGCACTGGCAGTTGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved