Rattus_norvegicus Locus Poly:8:SNORD49
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:8:SNORD49
Rattus_norvegicus
Poly:8:SNORD49
10
SNORD49, SNORD49, SNORD65
1001..1071, 1543..1614, 2446..2517
3517
TGAAGGGATAGATAGCACCAGCAGTTTTCTATTAACCACGAGATAAGCCGGATGCAAGT
CTCTCCAGTCAGAAGTGGAAAGAGTAGGGGGTAATGGAAATGGATCGAGCTCTTCTTGAT
TCTATATTTCACTAAGGAATGTGATGACGGCCGTCTGCAGAGGGTCTTGAGTAGTTCCGT
GGTTGTTAAAACGGTAACGGGGTGCAGACGGACCCAACCACTACACTTTGCACCCGCTAC
TGTTGCTTATTGTCTTTGAAAGCGGTTTCGGGTATGTTAGCTCGATAAGCCAATGTTTTA
CCCTCCACTCCCTGGTCCTGAGGATTAAATGCATGTTTACACAGCAGGCTCTCCACCACC
CAGCTAGATTATACTGGCCCGCTATATTTCGTTTATTTTAAAATTTATTAGAGAAAGGGG
CTAAATTGCCCAGGCTGAACTCGAATTCCTGCCTCAGGGTCCCTAATCGATTACGATTAT
AGGCCTGCACTGTCAGGTCTGATTACACGTTTACAAACTACACGCGTTTACAAAGGACTG
TGAATTCACAAACGGAAAACCGCTGAAAAGGGGCCGATTCCGCGATTAAACCACCACGCA
GGCGCACTGGAATTCACTGCACTCTTTGCTACCCAGAATTCCCGGGGCGGTGGAGACCAC
TCGCTCAACAGAACGGGGGAGACCTGGGTAGAGAGGCGGGCCTGCTTAGGTGCGCTGGAA
GTTCCCGTGAGCCTTTGCCCCCCTCTCGTGTGAGGAGTGGTCTGTTCCAAGCCCTTAAGA
ATAGGACGCTCACACGTTGCTCTTTCTCTGCGGCCATCATGGGATCATGTTCCTCATCTT
CCTGTAGCTGGTACTTTCGCCATGGCCTGCACTCGGCGGGCCGCAGCCATGCTGAGCCCG
GGCCCGGTCTCCCAGCACCGCCCTGGGCGCTGCGCAGATCTAGGGGAGCCTGGTAAGTCG
AGGTCTCCATCACGGGGCGCCGCTCGTGGGCGGGTATCGACTGCACTGATGAAACTAGAA
ATAGGAAGTGCCGTCCGAAACGACAACTGACGACATCTCTATTTAGCTGACTGCAGTCGT
TCAATCCTTGGCGACCCAGTGCTGAACATGAGTGTTAGAATTGTCTCTTGATTCTTATTT
TTCCTAACCTTTCAGACAGGACGTTGACATCGTGGAATAGGAGCACTATCCCACCATGAG
GTAAGAGTTTCTGGAACCATCGAAGTGGCTTAAGTTGTGCTACTGTATAGTACGTTCCAG
GGACAGCCCTAAAATAAGGGTTGCACTTGAACTCCTGTTTTATGCAGAAGTATTCCTAGC
TACGCTTCTCCTGGGGCTGGAGATGGCTCAGCTGTTAAGAGGCATTTTATTTTGTATCAG
ATGGGGTTCATAGCCAAGAGGGTCTAGCTCCAGGGACTCCAACATGTTCTGGCCAAGGGA
GACTTCATTCACACTTCCCCACCCACGTGGACATGTGCATAATTTAAGAAGGGCTTCCAC
TTAACTGACCTACCAGTTGGAGTGGGACAGTGGAAAGCTTGACTGCTGTGATGAGGACAC
CAGTAGGAAGTGCCGTCAGAGTCGATAACTGACGATAACTTCTCCCCGACTGACTGCGGT
CAAGCCCACGCTAGTGGCTGGTGTTTAGGATTAACTTGGTCTGGACTTTAACAACTGCTG
TGCTTTCTAGGTTGGGAAGTTAGGGTGGAAGATTGCCAGCAGCCATGGCCTCCCATGAGG
TAAGCTTTCAACGTGGGATTTTAGTTGGTTCAGACATGTTGCCCTGATTTGAGCTAGTAT
TAATGTATGAGCACCAATCAATCTTACCTACCTGTACTCAGTACTGGTTGTAGTTGATGG
GGAGAAGGGGTTAAGTAAGGCAAGGTAGAGTGCATAGCTCTGAACTCCAGGGCCATTTCG
TTTTTGTGGGTGCTGGAAAAGATACTGGACTTTGGTGGTTGTGAGCCACTATGAGTCTTG
GGAACCAAACCAGGTCTTGTGGAAGAGCTCTTAAACCTTCCAGTCCATTAACTTGGGTCT
TAAAACTTAATGTGTTCTTACAATTGAGCCCACATGGGCTGGTTTGGCCAGCACCAACTC
ACTGGCTCGTTCCAATTGTCTTTTAGTAACTTGGGAAATCTCCTTGTAAGGTCTAGGATG
TGCTAAGAACTGTGGGTTTCTTGGGAAGAAGAGGCAGGCAGAGTTTAGGCCAAACCTGGT
TTACAGTAGTGAGCCAGGGCTACAAAGAGAAATCCAAGAGAAACACTAGGAAAACCAGAC
TTTTGAGAGGCTGCCATTAGAAATAATGTCCTGTTTCTGCAATCTGTCTTAGGGTGTCCC
TTTCAAGTTTGAGAACGCACTGGGGGACTGCAGATGGTGTTGACAGCAGCTGAGGTGAGT
TGGTCTGTACAGTGATTAGCTGTCATTACTCTGAAACAAAGATATCAAATGATGATATCA
CCTTAAATAGCTGGAATTACCGGCAGATTGCTAGTGGTGAGCCTATGGTTTTCTGAAGAT
ATCTCTAAATGTTGAGAATGCTATTAGTCCATGTAGGAGTGATTCTGAAATTGAGTTGTT
TTTGCAGGCTACATTCCCAGGAGTCTCCAGCCATCACCCCAAAAGCAAGGTGTGGGTCAG
CCAACTTTTGTTCTGGACAGGCACGGTTGGTGGTCCTGTCTCCCACAGGATCTTCTGTAC
CATTTAATAAAGTTTTGTTTATAAGACTGATTGCCAGTGTGTTGGGTGAGTTCTTTTAAG
CTGTAAAGAGCACTACATGTAATGAAGCGTAGTCTTTGGTCTTGGTCCTTAAAAACATGT
ATTTGCAGAGTAAAGTCGAGTGTCAGGTGTTAAACAGTCCAGCTTTAGCATTGTAAACTT
CTAGTCAGTCTAGGCTGTTCTCACAACCTAAGACTTAAAGGTTCCAAAGCATGTAAGGCA
CCCACACTCAATTCCTGTCCTTGGCTGCATTTGTGCAGTACCATGCCAAGACACCATCTT
GTCCAGATCCTATAAACTAGTTTGCTAACCTGGCCTGTAAGGCTGTGCTTTCCCGTAACT
GAGTTCAGATATTGATAATAGTTCTTGGGTTTAAGTGGATGAGCAGTTGCTCACTGTTAG
GGACTAGGAGTGTTTGAGTGCTAAGAACCCCCAGTTCTCCCTCTTTGCTAACTAGGACTT
AACTGGTCTGGAGCCTTGGTAAATAAGTTTGAAAAGCCAATACAGGGAGGACTAGATTAT
GGGAGAAGGGCCTGAAACAGCTGGTAGAAAAGTTGTACTGGTTGATGGGTAAAGAAACCA
GGCAAGGTATAGCCCTACACAGTAAGATTGCCACTACAGCTTGAACTGGGCTTTCCACAC
TTGGTATCCTGAAACACTACCTTCAAGAAGGCCCTGGGAATAGGAAAGTAGACGTTCCAA
GAGTCTTGGAATAGGTTCCTATGTTACCTGCCTTAATTGTAAGTGGGCCTGATAACTTTT
GGTCCAGATGCACTCACTGTTCTAGGACAGCTGAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved