Rattus_norvegicus Locus Mono:307:SNORD36
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:307:SNORD36
Rattus_norvegicus
Mono:307:SNORD36
2
SNORD36
1001..1073
2073
AATTTCTCCGGCAAAGGGGTGGTGAGTTAAGTCGGGGCCTGAGTAGAATCAAACAGTAG
GAACCGTGCTCCCCTTAGTTCTCGCCATCTCGCTCGTTTTCACTCAGGAAGCAGAAAGAG
TCCCAGGCAACACGTACAGTACTTACCGCTCAACAGGAGAAGCAAAGGATGGGGAAAGAG
GTAGGAAAACACAAGATGTGTCCGTCTCAAGCTACACTTTCCCGGTCAGTCAGTGTGTAT
TGGTTTGATATTATGCACTGTGCACGGACACTATGTAAAAAACGTTAAGATTTAAAAATA
ATCCCTGCCATCAGGGACCTCACAATCTGGTCAATCAAAACAAATGCACCAGGGCTGCGG
AGATGCTCGGTGGTGAAGAGCATTTACTCTTCCTGGCAGGGGACTAGCACCGATGTCAAC
TGTCCCTGACGCCAGGGAATTCGAGGCCTTCTTCTGGCTTGCACAGCACTGCACTCACAG
AGACACGTACACATGCATGCAATTAAGCATAAAAAAATCCCCCAAAAACACCTGTGGAAA
AAAAAATTAAGAACAAAGTGCCACGTCCTTAAATAAAAACATTCCCTGCAGATTCCATAA
ATACACGCATATACACAGAAACACCTCTTCACACAGAAACATTATCACCGCAGAATTAGC
TATGATGAACTCCGGTGGAATTTCTGACTTGTCTTTTAACTCTTTAGAGTTTTCAGGTCT
TTTTCTACCGTGAAAGCATAGTGCCTTGAGAAGGGAAAACAGATTAGCACTTCATGAAAA
ATGTGGTAAAGATGCCGCTTATGAATGCAATGGTGTGCATAGAAAATAACCTGTGATGTA
AACAGAGTTACACAAAAGCACACACTGAAAGGAACCACATGGTGTTATCAGTGACTTCTG
GACCTGGGAACTACAGTGATTTTTGTGGTGTTTTTCATTTTTTCTAGGACTTTTTTCACA
AAGAACAAACAAACAAATTCCCTCTGTTTAAATTCTAACGTGTGCAGAGATGTGTGCGTT
TCTTCACCTGAAGTCACTGTAGAGTGAAACCGAGCTTTTTGACCCTAAGTCACAGTCTGC
TGGAACTGCCCTGTGGTGACGGTAGCAGCCCAAACACACAGGCAAAGTGTCTGTGTGTTC
TAGAGGTCAATACCATCGCCACCTTGGTGGGGAACAGGAAGGCTCGGCTAATGGCGATTG
TCCATTGAGTTGGTGTTCCTCCTGCCTACCCTGTGTCACAAGATGGGGGTCCCCTACTTC
ATCATCAAGGGAAAGGCCAGGTTGGGCGCCTGGTCCACAGGAAGACATGCACCACTGTTG
CCTTCACACAGGTGAACTCAGAAGACAAGGGTGCCCAGGCTAAGCTGGTGGAGGCTATTA
CAACCAATTACAATGACAGATACAATGAGATCCGCCGCCACTAGGGAGGCAGCATACTGT
CTGTCCTAAGTCTGTGACTCACATTGTCAAGCTGGAAAAGGCAAAGGCTAGAGAACTCGC
CACTAAACCGCGTTAAATGTACACTTAAGTTTCCTGTACATAAGTATAAAATTATCATCC
ATGGAAAAACATTTTTTAAAGAAATTCAAACACTAAACACTTATTCACCCTTGAGCTGGC
TGATTTTGCTTGTGCACAGGGGTGTGTGGGTATGAGGATGGGTGTAGGATGCTTTATCAG
TTTGACACAAGAGTTATCTGAGAAGAGAGAACCACAATGGAGAAAAAGGCCTCTCTAGTA
AGCACAGAGCACTTTCTTAATTAGTGGTTGGGGTGGAAGGGCCCAACGGACTGTGGGTGG
TGCCACCCCATGCAGGCCATCATGTGCTGCCTAAGAAAGCAGGCTGAGCAATCTTGAGGG
AGTAAGCCAGCAAGCAGCACTCCTCCATGGCCTCTGCGTCTGTTCCTGCCTCTAGGTTCC
TTTCTTGAGTTCCTCCCTGGACTTGGATCAGTGAGAATCACCTCTTGTCACCTGAGAGTT
GTAAGCCAAAACAAAGCTTTACCTTGCCATTGCTTTTGGCAATGGTGTTTCATCACCACC
AGTGAAATACTAACTAAAACAACAGTCATTCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved