Rattus_norvegicus Locus Mono:610:SNORA32
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:610:SNORA32
Rattus_norvegicus
Mono:610:SNORA32
1
SNORA32
1001..1100
2100
CACAGCATGTTACAACTATCTATTAAATGGTATATTTCTGGAAACTTTATTATAACTAA
ATATATCCGCGCGTCACTATGTTCTGCACATTTCCAGGCTCAACATGGCTCGATGCTATA
GTTTCTCTTACAAGGGCATGGCCCTGGGGTCCATCCAAAGCACAGCTTAGGAAAAAGTCA
GTGATGCAGTCACTTCAATACAACATACTAATCTTCCTGATTTACAGTCTAAGCAAAATT
ACATACAAAATTACATATAATCTACAGGCTGAAAACTTATTGAAGAAGTCAATTTATCAT
GATGTTATCACAATGAGCACTTAATATTTTCTGCCAATATGGAGCTGGCATTAGGATTAC
TGCTCTTACTATGAACTTAAAAGAATATCTTGGGTCAAAGGAACATTTTAAGGGCCAGGT
ACGGCAGAACATGTGTATAATCAATCCCCAGCCTTTCATACACTGAGTACATCAAGTATC
AGGGTAGCCTGGGCTACACAGTGAGCATGAGGCCAGCCAGTTAGTTATACACATCAAGAC
CACACTTTTTCTTTTCTTAAAGTAACATTTAAACAATGGCTCAAGTTGTAGATCTCTTGC
TCTCTTGGCACAAACATATAAGCCTACATCAGGAAACTGAAACAAATGGAAACTGCACAT
GGTAAATGGAGGCTCAAGTGGTCAAAGGTAAAACCTGTCTTCACCAGCAGTTGAATCTAC
ATAGCTGAGGATAACCAGAGAGTTCAACAACAGTCTCCCTCCCTTACGAACTACGGACAC
ACACACACACACACACACATACACGCACGCACGCGCGCGTGCACGCAAGCAAGCAAGCAA
GCAAGCACGCATTGAGGGGGTGGGGGTACGACAGACTATAGAGTTAAAAAAGATTAATAG
CAAAAAAAAAAAATCCAATAAAAGAAAAAATGAGTGGATGGGTGAGGAAGCACCGTCATA
AAAGAGGAGAGAGGGGGAATGGGATAGCAGGTTTCTAAAGGGGAAACTGGTAAAGGAGGT
AACATTTAAAATGTAAATAAAAAATTCCCATTAGGTTTTCCATATGCTACTTGACTAGCA
GTTAACCTGTTGGGAACATTTTTTGAGCAAATCTTTATCCAGTTGTTACTTTATATGTAG
ACGGTTCTAGAATACTCATCCCATTACTCCCATGTTCTTATTATGCAGGGCTGAAAAGCA
CAACTGGATGACCTTGAGAAAGGGCTATTTTCAGATGGCCTGGAGAGACAGCAAAGAAAT
CAAACCAACCCCTTAAATAAAAATTTATTGACAATAAATAATTTTATACATTAAAAAAAT
GTAAATGAAAGATATCCAATAAAAGAAAAAGATCAGTAGCTGCTGGAGAGTGGAAGGGAA
CTTAATATGAACACAGCAGATTCTTAAGGAGTGAAACAACTCTGTGTAAGTACTATAGTA
ATTAATAAATTGGTCAAAAGCTATAGAACTCTGTAATAGAGTAAATACTTGCTGTGACCT
TTAGTGACTTGTTATCAGGGTTGGGGAGATAGATAGTACAGCTGGTAAAATGTTGATGTA
CAAACAAAAGGACTGAAGTAAACAACACAGAAGAAAGACAGGCATAGGTATAAAGATAGG
TATAAACTTGTAATCTCAAAACTGTGGAAGTCAGTGACCCAGGTGGACCCCTTGAGTTAT
TCATCCAACTAGTAAGTTAGTTCTAGCCAGTGAGGAACCCTTGTCTCAAATACAAAAATG
GATGGCCTCTGCAGAGTAACAAACAAGGGAAACTTTTGACCTCTATACATAAACATATAC
AAATCCACATAAATTGTAACACACACACAAAAGTTATCCTTATTTGCCCATCAGTTCTAA
CAAATGTAGCAAAGAAATGGAAGAATCTTACTAAGGATAACAGAATGGGGAAATTGTACT
TCCTGCTCCATTATTCAACATGCCTGTACTCCTAGTATTTGGAAGGAAGGCTAGAAAAGA
AAGATTAAGAGTTTAAAGTTGGGCTGGAGAGATGGATTAGCGGTTAAGAGCACTGGCTGC
TCTTCTAAATGTCCAGAGTTCAATTCCTGGCAACCATATGGTAGCTCACAACCATCTGTA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved