Rattus_norvegicus Locus Mono:151:SNORA76
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:151:SNORA76
Rattus_norvegicus
Mono:151:SNORA76
6
SNORA76
1001..1117
2117
GGTGGGAATGGAAGGCCTGAAGAGATGGCTCTGAGCTTAGGAATGTTTTCTCTTCCCTG
CCCCTCACCAGCTATGCTGATGGTGGCATGGGCACTGGAGAGCTGGCCCTGCCCCTCTCC
ATGGCTCTCCACAGGCGATTGTTTCTGGCAGGAGTGAAGATAAGGACTCACCTTCTTTTG
GCAGGCTGGCCACTAGGAATCTGACTGTGCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT
TCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTTCCTCCTCCTCCT
CTTCCTCCTCCTCCTCCTTCTTCTTCTTCTTCTTCTGTGGGGGGGTTACAGGGGAGGAGG
GCAGACATAGGAGGACTGGGAGGTAAGTGAAATTGGGGCGCATAATGTGAGATTCCCAAA
TGATCAATTTTTTTTAAAAAAAGAATGTTTTCTACTCTTGCAGAGCCTAGACTTCATCTA
CATTGGGCAGTTCACAATTGTTCACAACTCTAGCTTTGGGATATCTGACATCTTCTGACC
TCTATGGGCAGCCACAAGCATGTGTATATACAGAGATACACACAGACAAACTCACACAGA
CACAGACAAGTAAAAGTAAAATTTAGAAAGAAAAAAAAACGGAGGCCAGCATTGCTAAAG
CATTGCCTTGTGGGAGGAAGGTAGCTGTAGGTTAGAAGGGACTGATATTTCACTTTCTGG
GTGGTGTCTCTGCAGGCAAACAAGTTCTACTTTGGCCTAGATGCTGTAGAGGCTTCTTGA
CCCGCTGCTCTACAACGTGGCATTTATGAGGCAGTGGTGAACACGGTCTTGCAAACACTA
AGAAGAAAGTGGCACAGTGGAGCCCTGATGATATCCAGAGAGTGTGCCTGCCTGCCTTCC
AGACCCATGCACTGGCATAAGAATTAATAAGTCTAGGAACGTTACCAGTTGAAGCCTCAC
AAATAAGTTTATAACTTAGCAAATAAAAACATAAGCACTACACACTACCTTTGAGCCCCC
GGCGCAACTTCTTGTGGTGCCGGGGGTTAGGCTGTGGTGCTATAGCACTTTGCTGGCACA
TAACTGGGGCTGCCTGCCCTTCTCCCCGAGCTGAAATGATGGGGTGCTTGCCCAGCATGC
ACGAAGCCCTCCAGCACCATAGAAAACCAGCATGGTGGCACACTCTTGTAATCTCAACAT
CTAGGAAGTGCAGACAGAAGAACCAGCAGTTGGAGGATATCTTCCACTAAACAGTGAGTT
CCAGGCTAACCTGTCTTAAAAAAAACAATATCAAAACAAAATAAATCATTCTGGTGCCAA
TACGAGTGACCATGGGCTGAGAGCATAGATTCAGGTTACCCCAAGTTCCATGTTCCAACA
TGGAATCAGGATCAAGACAGTTTTATAATAATAAAACAAAGTCCTAAATCAAGGCATTTA
ACAGACATAAATTGGTGGCAGGCTTATAGTCAGGCAGAGAAATCGCAGCTATAGGTCCCT
GAGGCTAGCTAATGACTTCCTTAACCCTTTGGTGAAGAACAGGCTTTTGTTGGTTTAATA
CATTCCAAAGGCTTTTATCTGCACAGTGGGATGTTAGGTCCCATACAGAGGTGGGCAATA
ACATGGCTCTTTAAAGGGGGTAAAGATAGCCCAAGAGAAATTGTAATCAGTCTCTGGACC
TGTAACATTTCAACCTCTCCAAAGTCATGGCTGTTTTAACCAGACAATCAGCTTTTGCAG
ACACAGTTAGCTTCATTCCAGGGATTCTCATTCATAGCACAAATGTCCCTGGTTTGTCTG
AAGCTTCTAATTTAACTAACGCCCCAGGTCCCTTTTGTTTCTTTGCACTTGTGGTGCAGT
CCTTGAACCCAGCACCTCACATACAGAGTAACATTGCCAACCTCACTTTGTTTCTTTCTT
AATTTTGTCACTTGTTTTTTTGTCAATCCTACCAATTCCACATGCACTAATAAATACTTG
GCCTACATCTGCAAGGACGAAGGCCAAGTGCTGCCCTGAAAACTACATTTGTTACCTATG
ACCTTCAGTACCTAACACTATCACATACGCTCTGTCTAAAGAACTGGTCTGAAGTTAGGT
TAGACCCCACTGTGCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved