Rattus_norvegicus Locus Mono:291:SNORA29
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:291:SNORA29
Rattus_norvegicus
Mono:291:SNORA29
20
SNORA29
1001..1141
2141
AAATTAAGAGAAAGAACCAAAGTTCTTCTTATAAAGAACTCGAGAATGTTAAAAAAAAA
ATAAATAAATAAAACCACTTCACAAACACACAGTGGTGTTTGAACACCTCCTCAGAAAAT
GAAGTCTTTCTTAACACCATAGGCCTACAAGGAAATAATCAATCCCCCCACTGCTCAGTA
AGATGATGCTTTATTAGAGGCAGAGGCAAGACAAGAAATGGAAGTCACTAAGACTCTCTT
TATGGGAGACAAGGGAATTTTCAGCTTTCTAAGAAAATAACCTCACTTAGCCAATGAATC
AGGGCAGAAATTAAATAAAAATAAACTAGGATCAAATTTGCAATTTATCCATATTCTGAT
ATCAGTATGAAAGATCAAAATAAAAGATTGCTTACCCAGAGCCAACATGGTATGTATGCA
TCTGCTAAGATCAGTGACTATTTGATGTCACAAGAAGCAAGAGCAGTTAGCAAAGGATAC
TTTGCAAGAATAAAGTGAAGAAAACTTTGATCTTTCCCAAGACCAGGAAGATGTGTCACA
ATTCTCAGGATTCTGGACCGTGGCAACTTCTAATCATCCTGGTGAACACGGACCATCTGT
AGCTCTAAGTGATCATGTCCTACAGATCAGGTTCCAACTAATGACTGGTCGGGGGACCTA
CCCCTGTTGTAAGTCAATAAATATCTCTATTCCTTTTCCATGGGAAGAAAGGGCTCAGAG
CGGTCAGCTATGAAAACTACTGTCAGGAAAAAGATTAGTATGTGACCAGACTTCTGATGG
CCTTACTGAAAGATGACAATGTTTCACGTGCTACAGTGTAGCAGGAAGTACTGTTTCCTA
TAGTGGGGTGAAAGAGGACAATGTTTCATTGCTACAGTCTATCAGGAAGTACTGTTTCCT
ATAGTGGGGTAAGAGCCTACATCTCCCACATCCTAGTTCAATTTCTCAAGTCGAAGTCCT
GCACTTCTGGAAAAAGCTAAATTTCACTCTGTTAACTGTATTTGCTAACTCAAACCTTTC
TGTTAAAACCAAGAGCAGTAGTTTAGTGGCTATGCTTATGGGATAGATGAAAAGTGCCGT
GATCTGAAGAGGGGGAGTTGTTCCGTGTCTTTCCTCTATATGAAATGGCTGAACAGAAAA
AAAACAAAAACAAAACAAAAAAAAAAAAAAACCAAGAGCAGTGTTGCATGCATGTTTTAT
TTCCTTATGAGAAACAAGTATCTTTCAGATATAATTTTGTGATGTAAAACTTCACTGACA
GTATACAGTTAAAAAGGATATACAACAGAATGAATTTTCACAGGTGAATGCACTTCTAGG
CTCAAGTTTTTGGTTGGGAGCAGAGATGAAAGGATTTTGGGGGTCTCTGCATGACCAGCA
GAGTTTTAAGACAACAAGGAAATCCAGTTCAACATGACTCAGTCGCCAGTGTTAGTTCAA
ACTTTTAGTCTGACACTGGGCAGTTTATTATAGTCATGTTTCAACATGGCACAATTTTGG
GGAAAAAATGTTTCCTGATGACAATTTAGTCAATCCCGTGTAAACAACAGAGATGTAGAC
ATTCTTATGTTGAAATTCTGTTTTACAGAGTACATATGGTTCTTATTGACTCAGAAACAA
CACTCAAGGTAAGGGTCTAGGGAGAATGATTGAGATGGACATAAAAGTCTGAGGTGACAG
GAATGGTGTGGCCCTACAGATAGCACAGAGATTACCCAGGCTGTTATAAAGTACACGTGG
CATTGCCTACAAGAATGGGCTCTACCAACTGAGAAACAATGCTCAAGATCAAGTTCTAGA
AGGAGGGAAAAGTCTGGGATAGGCTTAATACTCTGGTAGATTCGGTGTGGCTGACCTTAC
AGAGAGCACAGATCACCAGGATATTAACTACATCCACACCCAGCTTCCCAGGGAGAAAAT
TACCAAACTTCTGCTGTTTAACATCTGCGCATGTTTAATATCCCCAGCTTCCCTGGGACT
TATCTGTGAGCGCAAGGACCTTGTGCCCTCTCCAAAGTGTGAAGAGGAACCTAAGGACAA
AGGAAGATACACAGGACCATACTCAAGAGCATGCAGTCATGGTGCCAAGGACATTTTATA
GATTGTCACGCAAAGTGGTTTCTTGTCAGAACAAGTTACACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved