Rattus_norvegicus Locus Mono:418:SNORA52
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:418:SNORA52
Rattus_norvegicus
Mono:418:SNORA52
17
SNORA52
1001..1130
2130
GCTGGTGTGGGTGCCTCTGCCGGTTTTCTTTGGTGGTCCCCTCACTGAGCACCCTGCTT
CCATATACTCAGCTTCACTCAGACACTCCGTATCTTCAGTTCGTTCAGTGAGAGGAAAGC
AAACCGTCTTTCTTATTGAGTGCTCTATTGCTGTGAGAGACACGGTGACCACAGCAACGC
TCATAATAAAGCATCTAACTGAGGCTTGCCTACAGTTTCAGAGGTTTAGTCTATTGTCAT
CATGGAGGGGAACACGGTGGCACGCAGGCAAGCGCTGCAGAGTTCTATATCTGGATCTAC
AGGCAGCAGGAAGAGAAAAAGACACTTGACCAGACTTGGGCTTCTAAAACCCCAAAGCCC
ACCTTGCAATGACACACTTCCTCCAGCAAGGCCACACCTACTCCAACAAGGCCACAGACG
TCTCCTAACTCTTCTCAAACAGTGTCACTCCCTGATGATCAAGCGTTGCAATCTCTGAGC
CTATGGGAGTCACTCTTATTCAAACCACCACAGAAACCATTGTGACAGCAGCAACATCAG
ATTGAACAAAACAGAAACACACTTGAAATCCCTGCAGGCTCCTGAGTACATCACAAACGA
CTCTAAGTGAAGGACAAGCTAATGCAGGATATGCTGTGGAGTTAAAATGATCCAGGGTAG
ACATGGAAGTAATAAATCAATCAGGTAAAGAAGAAAGTAGAAGAGAAGAAAGAGGAAATA
CATTGCAGAAATACAGGAGGAGTGGAGAAGAGAAAACGAAAGAGAAGAAAGATTTAAGGA
AAAAAAGAAAGTTTTCCTGGTAATATGAAAGTTTGAATACAAATCTAGATTAAAAACCAC
AGGGTTTTTTTTTTTTTGGTTGTGAGCCTAGCCTTTAACGGCTGAGCCATCTCTCCAGCC
CCAGGGTTTTTTTTTTAATAACAGCAAAATACTACTAAAAGTACAGTAGAGTTTTTTTTT
TTTAAGGAAGAAACGGGATGTGTAAAGGGAAAAATAATAAAATAATAATCAAAATGGTCA
GTCCGTGATCTGCCAGGTTTCACCTGTGGACCAGAGCATCCTAGAAACCCTGCCAGAGTT
GTGTAAGACCTTTTTGTTTTAGGCTTGTGCCGACAGCACTTCTGAACATGCCAGGGGGAA
AAATAATAATTAAAATGTGTAAATAAAATTAAATGTATGCACAAAGCAGAATAAAAATAA
AAATATATTTTGGAGATACTATGAGGTCAAAATACTGATAAGATGTAATAAAAGAGGGAG
AAAAGGAATCCTAAAGAGCCAAACGCTAGAGTAAAGGAGGAGTGGGGATGAGAGGGGGAA
GGAAGGAGGGGAAGAAGGGGGAATTGAAGGGATAGAAGGAAGAAAGGAAGTAAAGATGGG
AAGGAAGGAAGAACAGAGGTAAGAAAGAAAGAAAGAAGGAAGGAAGGATTGGAGCAGTCT
CCCTAAGGGTTCCTGTAGATGTGTCTTTTCTATGGCTTATGTATTGGACAGCTGCCTGGT
GTGAGCTAAAGGAGGTTCAGTTTTAGCAGTGTCCCTCCTCTGAGTACCAGGAGCCTCTGC
TGGCTGTGCTTAGCCTCACTTCTCTCACCCTCCTCAGTCCCGGAGCTCTGAACTTGGTCC
TCCTGCAGTGGCTGGTGTTTTACTGTAGAAATGTCTACCAAATGCTTCTGGGTGTTAGAA
GCAACCACAGCACTGCTAGTGATACAGGCAGAGAGAGGACGCATCACTAGGTCCTTTCAA
GGCCCCACTGGAGGGGTGTAGCTGAAGTTGAGCTCTGACCTGCTTGGCCTTGAGTTTCTA
GTCTGCTCTCTCTGAGATCAGGCTGGGTCTCTCCACTCTGAGGTTATCCTTGGGTGATGA
GGTCTAGTCCCAGCCACCAAGACTTGGGTTCCCTTTCCCTGTGAACTCCCGCTTTCCATA
ACTGTCTCCCAAAGCTGTCTCTTACCTTAGGGCCACGGCAGATTAAACTCGGGCTTCCTG
TCTTGTGACTGTTTCCCATTCTCTGGTTCAGTTTTGAGCAATAGGTTCTCTCCTGAGATT
GCAGGAGGCCTCTGTCCTGTGAGTTACACAGTGATACAAGAGGCCTCCTCTTCACTGCCA
ACCTGTCCTCTGGGGACGTCATCCCCTCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved