Rattus_norvegicus Locus Mono:194:SNORD93
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:194:SNORD93
Rattus_norvegicus
Mono:194:SNORD93
4
SNORD93
1001..1071
2071
CTTAGTTTCCTATTGATTTGCAAATTCTGAATTTGCCATGAGGAGGCTGAATGAAACGT
CAACTTAAAAAAATAATTTATTAGATTATTGAGGCAGGATTTCATGCTGGCCAAGGAAGT
CTTTCTGCCCTAGTACCCAAGTGTTGGGACATGAGCTACGGACATGAGCCACTATGCTAG
GTGAAGGCCATCTTAGAGGGAACTTAGTGTTGTGCGCTCTTGTAAACAACTACCTTATGT
GCTCTGCCTAATACTGCAACAAGGGAACATGGAAGTGGGGTGTAAGCCTTGCTTCTGTTA
GGGGTTATGTTTGTGTTAAGCAGTTTGCTTTGACGGAAGGCAGAACAGCATGAGCCACTA
AGGACTGCATAAAGCAAGTTCTAGCGTTTCGACTTCCTTGTTCAGTCTCAGCAAACAAAT
TTGCTGCTGCTTCTGGCTTCGAAGTCAATGAAAGTGGTTTAACTCGCCCGAAAGAAATGG
TGTAGAGGGCTGGAGAGATGGCTCAGAAGAGCACTGGCTGTTTGTCCGGAGTTCAACTGT
AAGCAACCACATGGTGGCTCATAATCATCTATAATGAGACCTGCTGCCCTCTTCTGGCAA
GTAGGCAGAACATTGTATAAATGATAAAATAAACCTTTAAAAGAAATACCGTAGCTAGTA
ATTTTGTTTCTAAACTTTAAGAGTCTGCTTCTGAGGTGGATTTAGTCAGAAGGTTGTCCC
AGAGGGAATAAAACAGACTCCCAGCTGTCAGCAGTGTGAAGGTCAGAGCCCTGTGCAGGA
GTAAATGCTCATCAGAGGCAGGACTCACAGCATCAAATGTAGCCACCAGAAAGGTCCTGG
ATATAAGAAGCTCTGACGTGGTACATGTTGCATTGCTGACTTTTTTTTTTTTTTTTTTTG
GAGCAGATGTGGCCGGCGCTGTGTCCAGGATGATAGTGAATTTAAGGTATGTGTCAGATG
GGAAGATTTGACTTTCCAGGGATAATCCCAGAAACAGTTCTTGGCCAAGGATGAGAACTC
TAACCTGACTGGATATGCTGCTGTGATGGGTTAAAGGATTTACCTGAGGCCAACAGAACA
GGCAGGAATTTAATGCAGTCACCCCACCCACATCTTTTTAAATTAGATGAGGGGCTTGGG
GACTGTAGTGAGAGGGCTTAGCAGCACCAGGCCCGGTCACCTTTGATTCTGGGGCCTGGT
GGAGAGAGCCAAATGTCCAAGTTCTTGGATGTCATGTGTGCTAGCACACCTGTGTGCACA
CTCAGTAAATAATCAATGGGAGTACTGGTGCATGGATTAATACTTAGAGAGAGAGAATTT
AAAGTCTTGTTAAAACATTCCTGAGTAGACGTACCCAGCGTACTGGGAAGTGCTGTAAGG
ATTCTGTTTATACAAAGACTGGTAATGTCAGCATCGTCTGCACGTCGGCGTGTTGCTGTA
TTCTCTAATGGTTTCAGGTCTAATCACCTCTGGTGTTTCTTCTGCAGCTCTGGAGTCTGA
GGTGAACTGGTTCAACTTCCAGAAGAGAAGGTAAGCAACCGTGTGGAGAGAAAAGGTTTT
AGGTTTCTTTGTCCCCCCCCTCATACTGGGAACAGATAAATTTTGAGGCAGTCCCATTGC
ATATAGAGAACATGAGAATTTTTTTGCCTGTAGAATTCAGTGCCATTATTTAGTTTTCTG
TGTGTCAGCTCTAGTGTGAATCTTGCTACAATATTAACATAAAAGCCAAATTTTGAGAAA
TTTGGCTTTATTTATAAAATTTTTACTTTTATCTGTTTTGCCTGCATGTCTGTGCCATGT
ACGTGCAGTGCTTATGGCAGCCAGAAGAGGGCATCAGATCCCCCAGGAATTGGAGCTGCC
TTGTCCGTTGCTGGCAGTTGAACCTCCAAGAAGAGCAGTGGGCCCGGGCGCTTCACAGCA
GCCCTAACCTTTGGCGACTCAGAATTATCCAGCATAGTTGAGAGATCTGGTGTTCCCGGG
AGAGTGAGGTGTGTGGTCGGCTCCACTGGGCGATCTGGCTCAGGACCTGCCGTGTGCACC
CTCCCTGTCGCTGGAGTGAGCAGACAACATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved