Rattus_norvegicus Locus Mono:554:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:554:SNORA44
Rattus_norvegicus
Mono:554:SNORA44
10
SNORA44
1001..1131
2129
AGACCGTCTTCTCCTGTTGGCTTTTAGAACAAGCTACAGAACTCTCAGCTCCTCCCATG
CCATGTCTGCCTGGATGCTGCTTTGCTTCCTGCCGTGATGATAATGGACTGAACCTCTGA
AGCTGTAAGCCAGCTCCAATTAAATGTTATCCTTTATAAGAGTTGCCGTGGTTACGGTGT
CTGTTCTCAGCAATGAAACCCTAAGACAGGTAGACAAAAGAACTCTTAAATGATCCATTT
GGGTTCCATTTAGGATGGGAGAGACATAGGGGGAAGGATGGTGCTAAGGTCTTGATTAGC
CACCTCATGAAGGGGAAGGGATTGCTTGCAAACGCTCTCTGAGCTCCCTATACGAGGGAG
GGGTGAGGAGAGGTCATCTAGGGAGGTGAGTGGTTAGACAGAGCTCTGTAGCTGGAGATG
AGAGAAGGGGAGGAAGGAGAGTTGGGTCTGAAAATCCAAAACAACCCAAATAGTCACAAG
AGTCCAGCAAAGCAAGATCTTTGAGTCAGGCAGCTAAAACTGACCAGTCGTGGACAACAG
CACAAGTATTAGGCAAGTGATATTGTATTGTACTCAGGCCGCTACTGATCAATCGGGGCC
ATGGAACGGACATGAGAGCTGAACTGTGACCCTGAAGAGAAACTGCACAGCATGTTTCAA
GGATGAGGCCACAGAGTGAGGGGAGCGGGGTAGGCTGTAGCATTGTCTGATTGTATTTTG
ACACAAGGGGTTGAGCAAGGGAGTAAGCATTGGTTCCAGGGTCTTGTCTGGGACACCCGG
TTTCAAGGTCTTTGACTGAGAGCCTTGGTTTTTGAGCCTCATCCTGGACATTTGGCCCAT
AACTCAAAATGAGAGGGAACAAAGGAAGTGGGGCAGCCGCATGTAGTTAATTAAGGCACA
GCAGACCTTATGATTTGAGTACCTAAGTTTAGGTAACAGGCAACTTCTTTACATTTGTTT
GTTATTTACTGGTTAATAGACAAGCAAGAAACACTGGGAGAAAGCATGTTTCCAAGGGCT
GTGGCTGCTCATAGCCATGGGATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGAC
AGCCCAGGTTATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTG
GAGTTATGAGCTGCCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAG
TGTGCACTTGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAA
CCTAAGGACCATGTGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTG
GAAAAATGCCACAAGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAG
GTAGCCTTTTGTGGCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATA
CCTTTGTAACCTAACATGCAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAAA
AAAAAAAAGAAACACTGGGAGAAGCAAAAGAGTTGGCTCCGTGAACTCAGCAGGATGGAG
AGGTTGTCCCTGAGATGGCTGCATGAAGACGACTGTCCCCTTACAGGAGAGGGGAGGTCG
GAGAGGAAATGGGGGTGGAGTTACTGAATGATGACATGGCTGGTATCGGAAAAGCTGGAG
GCTGAGCAGGAGCTTATGTGGAGGAAGGACAGCAAGACTGTCTGGCACATGAATCTCAGA
ATCCTTTCCTAAATTATGAGAGAAGTCTAATTACAGGAGCCATTATAGCTAAGTGTACCA
TTAGGCAGTCAGTGTTTCCCTGAGGGAAGGGCCCTTCCTGCCTCACTCTGGCACTAACCC
TGTCTAGTTGTTCAAGGAGCTGACCTTAAAGAACTACTCACATGCTGAAAATGGCTGTAA
GTCAGCTGTGAGGGAGGACTCACCATCTTAAAGAATGCAAAACCCTTCCTGTAAGTGTCT
CTGGCCAGGACATCTAGCAGGAGGAAACTATCAGGTGCAAACGTTACCATCCTAGTGGGG
ATTGCTTCCATTTTTTCTGAGACACAGGGTCTCTCAACTTATTCCTGGCTGACCTCTGCC
TCACAAATGCTGGGTTTTGAAGCTATTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_005109
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved