Rattus_norvegicus Locus Mono:283:SNORA4
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:283:SNORA4
Rattus_norvegicus
Mono:283:SNORA4
20
SNORA4
1001..1142
2142
CTCTGTTGCCACTGATAACAATGGAACCACCATTTTGTCAAGTCTCTTCTTTCTTCCCT
GATAATGCCAATGCACTGAGATTACCTTTATGCCATGTACACTGCAGCATTCATGGAAGT
CCTGGGACTTTATACACATTTAGCTCTTCCTATGATCTCTAATGTGATCTAACTCATTTC
TATCATCTTACTATACTTGGTCTTTTCACTTCCTCCTTGAGTCTATGGTATGTTATTTCT
ATTTCCATAGTGAATCAAGATAGGTCTTGTATGAGGTCTTTTTCTGGGATGGCTTTTCCT
GGCTTTAAACAGGAATACTTTTCTAAAAATTATTTCTTGATTCAAATTTTATCTCAAGTG
TAATCTTTCTTGAAAGGACTTATTTGACCATTTTGTAGATCAACATCTTTAAAATCTTAT
CAATGTCAGCTACTATACTCCAGGTGATCCTGTTGTTTCCCGTTATTACATTCATTTCTA
TTTTTATTTGTTTGCTTGCTTGAGTCTTACCTTCACTATAAGGTTAAAGGTTATTCATTT
TTTCTTTCTTTTCACGTTGAACTGCATATTGAAGGAATCTTCTATTTGTTAAGTTCAACA
AATGAAAACTGCAAGCCATCCTTTCAAATAAACATTGGGTTGTATTTTGACTCCAGACCT
GCTAAACATCAGCCATGTGGCTGTTTAAACTTGAGTTAAAATGTATTACATTTAAACATA
TCAATAAGTGTACATTATTTTTGAACCATATTCTAAGTGCTAACAAATCACAAGTACAGA
GATAAAACATTGGCATCAAATTTCTATTCAGCAATGCTCTATTCTTGAGAATGAGTGCTT
GTGCCATTGGAAAAGATTAAATGTTAAAGAGAAAACAAGTCAAAACAAAACAAAACAAAA
AAACAAACTAGACAAACGAAAACAAAAACAAAGCAACGTCAAAAACATTCTAACCAACTT
AGATTAAGTGGAAGAGTTTGAAAACCATTGGGGTTTCTTTTTAAACTCATTTAAATAAGA
TGAAATTCAGGTTTTATTAAATAACCTTAACCAATTCAGGCTATTTGGCAAAATGAGTAA
GACCACACTCCACAGTGGACTATACCACTTAGTATTGTTCATTACTATACTGTTGCCTAT
ATTGATTGCAGGGTCATCTAGATTTTGAATTATATTAAACAACTTCTCTGTTTCAGAAGA
AAAAAAATAAGATGAAATTTTAGCTCTGGAGAAGGTTTATTAGATATACAGCCTGGAGGT
GGGTTTTTGGATTTTGACCTCCCAATGTCCCATTCGAAGCTGCACATAATTATTCTTGAG
GTTATAATTAAATGTGTTTTGTATCCTCCAGTAGCTAAAGGTTTCATAGGACTCACAGAA
GATATAGTCCTTGATCTCAAAAATAACTTTTAAGACTCTTTTCAAACTGTATTTAAGAAC
AAGAGCATGTTGCAAAACCTTTACTAAAAGACTTCATGATGATGGATGACTCTGAGGAAG
TCTGTGTGACAGAACCCACTATTTCAAAGTATTTACTTGTCTTTTTAAATTTAAAAATAG
AAAAAAATGACCTGTCCTATTTAGTTTGCAAAACTTCAGAAGTGCTACAGATTAAATTTC
TAACAATTGTAGTCATGTTTTATTAGAGCCTTAGCTAAGGGCTTGTCAGAATTTTTGCAG
GCTGGTGTATCTTCTAGCTCATTCGCAAGTTGCATTAAGACAGCCCTCCTCGTCTAGCAA
CCAGTCAGAGCTGATTGCATGGTGCCCGAGACAATAATTTAAAAGAATGCATTTGCTGCA
TCTGAATACAAATGTAGCCATGAAGCTTGTTTTCTTTTAACTGAAGTCAAGTGACAGGAT
GGGACACTGCTTGTGTGAGGAAAATGCAATCAGGATTGAGAGCATTCTTCTGTTCCCCAG
GCAACATATATGCTGAGGGGCAGCAAGAGGAGAAGAGAAGGATCTGCTGTGATTGTTGAA
GCTTTGGCTGAACTTTCCAGAATGAGAATCTGCAGGTGGGTCCCAGCTAGGCAAGGAGAC
TGGCTTGATATTTGGAAATATAAAATCACATGGGAAATGGTTTCTCAAGCTGTTTTCATG
TTTCCTGGCTTGCAATGTCAAGGATTTCAAGCAAACAGAGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved