Rattus_norvegicus Locus Poly:16:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:16:SNORD115
Rattus_norvegicus
Poly:16:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2836..2913, 4848..4924, 8146..8223, 9986..10062, 11141..11218, 12978..13055, 15315..15392
16392
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTATCAAGGAGATGGTTTCTGGAT
CTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTC
ACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTGCTAACGCTC
AGGGATTCATGGCCAAAATACCTGTTGCTTTCTTCTGGGCAACAGATTCTCTTCAGCATT
CACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAAC
ATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAATTGGATTAAAGTATAC
GTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTT
TCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGACAAAGAGCATGTGTCA
TCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTAGAGAAGT
AACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTA
AGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATTGTATGAA
CTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCA
AATTCAAGCTAGGTCTACCCTTATTCCACACAAGAGCGCTGTGCCCTTGTACCCTCTGCA
CTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCAAGGTAAGCAATGGTGCA
GGTGAAATTACATTATTGACAGTTGTGTCCTACCTGTGTCTGGGTCAATGATGACAACAG
AAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCA
ACCAGGTAGCCAGGTTAACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGCTTTTG
TGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATATTTTGGAGTAATTATGAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCG
ATCAAAGGTTTCTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTTCTCAG
TATATTCTGTCCCTTTGACCTGCACTATTAAAAATGTAGAGATTTCCTTTCTACCTGAAG
TTCATACAGCCGTAAAATTGAATATCTTGGAAGAGATCCTAGATGATACTATCTACACAA
ATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCAACACAC
AGGATCACAAATCCAAGCTGTTGCACAGAGATCGATTTCCAATGGCAAGGGGAACCCAGG
AATAAGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCAAAAGACAC
TCCAAGAATTATTGCCCCAAAGAGAGCTTCGCAAAATTTTTCACATAACTCTCAGGCCAC
AGGGAAACTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCTATACCC
TTCTATGTGTCTTCACACAGCTTCATTCTTGATCTTACTAAAATTTACTTCAGTATTCAT
CAGAAAACAAATGCTATCAAGGAGATGGTTCCTCGAGCTCTTGGGACAGAGGAACGTGAT
GTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCACATTCTC
AGTTTGATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTT
GTTGCATTCCTCTGGGCAACAGATACTCTTCAGCATTCACTTACCACCTGTGGGAACTGA
TTGTTACCATGCAGTATTGAAATGGATAGGAATGAACATAACCTAGCACATAAAATCTGA
AATGCACAAGTCTCATTAAAATTTGATTAAAGTTTACGTAACTGTTCGTGTATTGTCCTT
CCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTAGCAATTGAA
AGATTTGATCGGTGTATATGACAAAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTT
TTGGGTACCTATTGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGT
CAGCATGGAAGTGGATGTTGCAAGAGGGATTCTACTAAGTGGCATCATACATTAGACTTC
TTAAACAGCCTCCTAAAATTAACATGATTGTATGAACTGAAGGGATACAATTGCCCTCAC
ATCTTGCTCTTTCCTTTTAGAGAGGACAGTCTTCAAATTAAAGCTAGGTCTACCCTTATT
CCACACAAGAGCGCTGTGCCCTTGTACCCTCTGCACTTGCAAGTGAGGATTCAAATTCTG
AAGATTTGTTGGGAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACAGTTG
TGTCCTACCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATGACAT
AAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCGGGGTAACAACACT
ACTTAGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGACCTTGTGC
TCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACTGCCT
GCCAACTAGCACCTAATCTCATTATCTGCTTGTGTGCAAGTCTGCAACCCCACCCGGGTC
ATCATTACCCTCTCTGCTCTGATGTCTTGTAGTCACCTGGCATCACCCCAGCGGTCCAGT
GGATCACTACTGCCAGGTGTGTGAAATGATCACGATTAATGGATTTAACTATTCATGAGA
TATTCCTCAGTATTTTGACCAATAATTTCAGCCCATNNNANGTTTCTTAATTAAAAATAA
AGCAATACCAGTCAGAAATGAATTGCACTTCTAAGTATGTTCTGNNCCCTTTGAACTNNN
NCTNTTTNAAANNNNNNNNNNNTTCCTTTCTACCNTGTANNNNNNNNAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTAATTAAAAATAAAGCA
ATACNNGTCAGAAATGAATTGCACTTCTAAGTATGTTCTGTCCCTTTGAACTGCACTATT
TAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTGAATTTCTT
GGAAGAGATCCTAGATGATACTATCTACACAAATGGAGGGATCTGGAATATGAATATACC
TTTTGAATTTGGAGTAATTTCAGTCCACACACAGGATCACAAATCCAAGCTGGTGCACAG
AGATCGATTTCCAATGGCAAGGGGATCCCAGGAATAAGACTTTAGTTTAGAGATGAAGAA
ATTGGCGATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTGCCCCAAAGAGAGCT
TTGCGAAATTTTTCACGTAACTCTCAGGCCACAGGGAACATAGCCAGTAGGGTAGATTGA
AGTTGTAGGTGTGGCTTTGGCTACCAATTCCCTTCGATGTGTCATCACACTGCTTAATTC
TTGATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAAATGCTATCAATGAGAGAG
TTTCAGGAGCTCTTGGGACAGAAGAACATGATGTCAATGGCATACTTGCAAACACCAACT
GATCTAGTCACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTG
CTAACGCTCAGGGATTCATGGCCAAAATACTTGTTGCTTTCTTCTGGGCAACTGATTCTC
TTCAGCATTCACTTACCAGCTGTGGGAACTGATTTTTACCATGCAGTATGGAAATGGTGT
GGAATGAACACAGACTAGCACATAAAATTTGAAACGCACACGTCTCTTGAAAATTTGATT
AAAGTATATGTAACTGTTCGTGTATTGTACTCCCCATATTACTCAGAGAAATTCACATTT
GTCTTGGTTTCTGACAATGTTTATCAATTGAAAGATTTGATCGGTGTATATGACAAAGAG
CATGTGTCATCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCT
TAGAGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGAGGATGTTGCAAGCGTG
ATTCTACTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGA
TTGTATGAACTGAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGAC
AGTCTTCAAATTCAAGCTAGGTCTCCCCTTATTCCACACAAGAGCGCTGTGCCCTTGTAC
CCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGGATCCAGGTAACCCA
TGGTGCAGGTGAAATTACATTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATG
ACAACCGAATTCAAGAACAGAATGATGACAGAAAAATCATGCTCAATAGGACTACACTGA
GGCCCAACCAGGGAGCCAGGTTTACAAGCACTACATTGTCTCTTTGAGGACCACTTGCAG
GACTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAA
TCTTAGTGCATCTGTGCTGGCAAACACTGCCTGCCAAATAGCACCTACTCTCATAATCTG
CTTGTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTT
GCAGTCACCAGGCATCATCCCAGCGGCCCAGTGGATCAGTATTCCCAGGTGAGTTAAATG
ATCACGATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTT
CAGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCAC
TTCTCAGTATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTCT
ACCTGTAGTTCATACAGCCATAAAATTGAATTTCTTGGAAGAGATCCTAGATGATACTAT
CTACACAAATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGT
CCACACACAGGATCACAAATCCAAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGGG
AACCCAGGAATAAGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCA
AAAGACACTCCAAGAATTATTGCCCCGAACAGAGCTTCGCAAAATTTTTCATGTAACTCT
CAGGCCACTGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGTAATTGTGGCTTTGGCTAC
CAATTTTCTTCTATGTGTCATCACACTGCTTCATGCTTGATGTTACTAAAGTTTACATCA
GTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTTTCTCGAGCTCTTGAGACAGAGG
AACGATATATCAATGGGATACTTGCAATCACCAACTGATCTAGTAACACGAATTTTGGTC
ACATTCTGAGTTTCATCACATGGCAATCACTGAGTACTAACGCTCAGGGATTCATGGCCA
AAATACTTGTTGCATTCCTCTGGGCAACAGATTCTCTTCAGCATTCACTTACCAGCTGTG
GGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGCACATA
AAATCTGAAATGCACAAGTCTCATGAAAATTTGATTAAAGTATACGTAAGTGTTCGTGTA
TTGTCCCTCCAATATTACTCAGGTAAATTCAGCTTTGCCTTGGTTTCTGACAATGTTTAG
CAATTGAAAGATTTGATTGGTGTATATGATCAAGAGAATGTTTGATCCCCTTCATTAATG
ATTTGGTTTTGGGTACCTATTTACCTATTGATCGCTNAGGGAAGTAACTTTCCATGTGTT
GCGAATGTCNNCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTAAGTGGCATCATACAT
NNGACTTNCTTAAACAGCCTCCTTAAAATTAACAGGATTGTATGAACTGAAGGGATACAA
TTGCCCTCATATCTTGCTCTTTCCTTTTAAGANGAGGACAGTCTTCAAATTCAAGCTANG
TCTATCCTTATTCCACACAANNNCACTGGGCCAGTGTACCCTCTGCTATTGCAAGTGAGG
ATTCAAATTNCTNNNGCAGTGTTGGCAGCCNNNGTNANNCATGGTGNNNGTGNAAATTAC
ATTATTGANNNNNNNTGTCCTGCCTNGTGTCTGGGNNNNNNANNNNNNNNNNNNNNNNNN
NNNNNNATGATGNNNNNNNNNNNNNGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTNCTCAGTATGTTTTGTCCCTTTGAACTGCACTATTNNNNAT
GTAGAGAAATTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTGAATTTCTNGNNNNN
NNNNNCNNNNNTGATACTNNNNACANANNNGNNGGGATCTGNAATATNNATNTNNCTTNN
GAATTTGGAGAAATTTCAGTCCACANACANNNNNANNNNNAANANNNNNTNNNCAGAGAT
NGATTTCCAATGNCANNGGGNNCNCANNNNTNAGACTTTAGNTTAGAGATGAAGAAATTG
GCGATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTGCCCCGAACAGAGCTTCGC
AAAATTTTTCATGTAACTCTCAGGCCACTGGGAACCTAGCCAGTAGGGTAGATTGAAGTT
GTAATTGTGGCTTTGGCTACCAATTTTCTTCTATGTGTCATCACACTGCTTCATGCTTGA
TGTTACTAAAGTTTACATCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTTTC
TCGAGCTCTTGAGACAGAGGAACGATATATCAATGGGATACTTGCAATCACCAACTGATC
TAGTAACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTACTAA
CGCTCAGGGATTCATGGCCAAAATACTTGTTGCATTCCTCTGGGCAACAGATTCTCTTCA
GCATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAA
TGAACATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAATTTGATTAAAG
TATACGTAAGTGTTCGTGTATTGTCCCTCCAATATTACTCAGGTAAATTCAGCTTTGCCT
TGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGATTGGTGTATATGATCAAGAGAATG
TTTGATCCCCTTCATTAATGATTTGGTTTTGGGTACCTATTTACCTATTGATCGCTTAGG
GAAGTAACTTTCCATGTGTTGCGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTC
TGCTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAACAGGATTGT
ATGAACTGAAGGGATACAATTGCCCTCATATCTTGCTCTTTCCTTTTAAGAGAGGACAGT
CTTCAAATTCAAGCTAGGTCTATCCTTATTCCACACAAGAGCACTGGGCCAGTGTACCCT
CTGCTATTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATG
GTGCAGGTGAAATTACATTATTGACAGTTTTGTCCTGCCTGTGTCTGGGTCAATGATGAC
AACAGAAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAG
GCCCAACCAGGGAGCCAGGGTAACAAGCACTACTTTGTCTCTTTGAGGACTACTTGTGGG
ACTCATTTGAGCTGCTATGATGAACTTGTGCACTATTCCCTCTGCGGGAACCTGGACAAT
ATTAGTGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGC
TTGTGTGCAAGTCTGCAACACCAACACTGTCATCATTACCCTCTCTGCTCTGATGTCTTG
CAGTCACCTGGCATCACCCCAGCGGTCCAGTGGATCACTACTCCCAGGTGAGTGAAATGA
TCACGATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTC
AGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACT
TCTAAGTATGTTTTGTTGCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTCTA
CCTGTAGTTCATACAGCCATAAAATTGAATTTCTTGGAAGAGATCCTAGATGATACTATC
TACACAAATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTC
CACACACAGGCTCACAAATCCAAGCTGGTGCACAGAGATCGATTTCCAATGGCAAGGGGA
ACCCAGGAATAAGTCTTTAGTTTAGAGATGAAGATATTGGCGATAAATTTTCTGCATCAA
AAGACACTCAAAGAATTATTGCCCCGAAGAGAGCTTCCCGAAATTTTTCACGTAACTCTC
AGGCCACAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACC
AATTCCCTTCTATGTGTCATCACACTGCTTCATTCTTGATCTTACTAAAGTTTACTTCAG
TATTCATCAGAAAACAAATGCTATCAAAAAGATGGTTTCTGGAGCTCTTGGGACAGAGGA
ACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCA
CATTCTCAGTTTGATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAA
AATACTTGTTGCTTTCCTCTGGGCAACAGATTCTCTTCAGCATTCACTTACCAGCTGTGG
GAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGCACATAA
AATCTGAAATGCACAAGTCTCATGAAAATTTGATTAAAGTATACGTAACTGTTCGTGTAT
TGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTAGC
AATTGAAAGATTTGATCGGTGTATATGATCAAGAGCATGTGTCATCCCCTTCGTCAATGA
TTTGGTTTTGGGTACCTATTGACCTTAATGATCTCTTAGGGAAGTAACTTTCCATGTGGT
GGGAATGTCAGCATGGAAGTGAAAGTTGCAAGAGTGATTCTGCTAAGTGGCATCATACAT
TAGACTTCTTAAACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAGTGATACAGT
TGCCCACACATCTTGCTCTATCCTTTTTAGAGAAGACAGTCTTCAAATTCAAGCTAGGTC
TACCCTTATTCCTCTCAAGAGCGCTGTGCCCTTGTGTCCTCTGCACTTGCATGTGAGGAT
TCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTA
TTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACTGAAAGTCAAGAACAGA
ATGATGACATAAAAATCATGCACAATACATTACCCTGAGGCCCAACCAGGGAGCCAGGGT
TACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCAGGACTCATCTGAGCTGCTCTGAT
GCCCTTGTTCTCTTTTCCCTCTGTGGGAATCTGGACAATCTTAGTGCAACTGTGCTGGCA
AACACTGCCTGCCAACTAGCACCTACTCTCATAATCTGCTTGTGTGCAAGTCTGCAACAC
CAACCCCGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCCCT
GCGGTCCAGTGGATCAGTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAACT
TCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTTAA
TTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTTCTCAGTATGTTTTGTCGCTT
TGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTCATACAGCCATA
AAATTGAATTTCTTGGAAAAGATCCTAGATGATACAATCTACACAAAAGGAGTGATCTGG
AATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACACACAGGATCACAAATCC
AAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGGGATCCCAGGAATAAGACTTTAGT
TTAGAGATGAAGAAATTGGCGATAAATTTTCTTCATCAAAAGACACTCCAAGAATTATTG
CCCCAAAGAGAGCTTCGCGAAATTTTTCACGTAACTCTCAGGCCACAGGGAACCTAGCCA
GTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCTATGTGTCATC
ACACTGCTTCATTCTTGATCTTACTAAATTTTACTTCAGTATTCATCAAAAACAAATGCT
ATCAAGGAGATGGTTTCTGGAGTTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTT
GCAAACACCAACTGATCTAGTCACATTAATTTTGGTCACATTCTCATTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGTCAATGATGACAACTG
AAAGTCAAGAACAGAATGATGACATAAAAATCATGCACAATAGGATTACCCTGAGGCCCA
ACCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGCCCTTGTTCTCTTTTCCCTCTGTGGGAATCTGGACAATCTTAG
TGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTACTCTCATAATCTGCTTGTG
TGCAAGTCTGCAACACCAACCCCGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCCTGCGGTCCAGTGGATCAGTATACCCAGGTGAGTGAAATGATCACG
ATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCC
ATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAATCAGAAATGAATTTCACTTCTCA
GTATGTTTTGTCGCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCCTTTCTACCTGT
AGTTCATACAGCCATAACATTGAATTTCTTGGAAAAGATCCTAGATGATACTATCTAAAC
AAATGGAGGGATCTGGATTATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACAC
ACAGGATCACAAATCCAAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGGGATCCCT
GGAATAAGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTTCATCAAAAGAC
ACTCCAAGAATTATTGCCCCAAAGAGAGCTTCGCGAAATTTTTCACGTAACTCTCAGGCC
ACAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTC
CCTTCTATGTGTCATCACACTGCTTCATTCTTGATCTTACTAAATTTTACTTCAGTATTC
ATCAAAAACAAATGCTATCAAGGAGATGGTTTCTGGAGTTCTTGGGACAGAGGAACGTGA
TGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACATTAATTTTGGTCACATTCT
CATTTTGATCACATGGCAATCACTGAGTGCTAACACTCAGGGATTCATGGCCAAAATACT
TGTGGCTTTCTTCTGGGCATCTGATTCTCTTCAGCATTCACTTACCAGCTTGGGGACTGA
TTGTTCCCACGCAGTATGGAAATGGGGAGTAATGAACACAGCCTAGCACATAAAATTTGA
AACGCACAAGTCTCTTGAAAATTTGATTAAAGTACATGTAACTGTTTGTGTATTGTCCTC
CCCATATTACTCAGGGAACTTCACCTTTATCTTGGTGTCTGACAATGTTTAGCAATTGAA
AGATTTGCTCAGTGTAAATGATCAAGAGCATGTGTGATCCCCTTCCTCAATGGTTTATTT
TTGGGTACCTATTGACCTTAATGATCTCTTAGGGTAGTAACGTTCCATGTGTTGGGAATG
TCAGCATGGAAGTGGAAGTTGCAAGAGTGATTCTACTCAGTGGCATCATACATTAGACTT
CTTAAACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAGGGATAAATTGCCCTCA
CATCTTACTCTTTCCTTTTTAGAGAGGACAGTCTTCAAGTTCAAGCTACGTCTCCCCTTA
TTCCACACAAGAGCGCTGTGCCCTTTTATCCTCTGCACTTGCAAGTGAGGATTCAAATTC
TGAGGCACGGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACAGT
TGTGTCCTGCCTGTGTCTAGGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATGAC
ATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGTTTACAAGC
ACTACTTTGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGCCCTTG
TGCTCTTTCCCCTCTGTGGGAACCTGGACAATCTTAGTGCAAGTGTGCTGGCAAACACTG
CCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCTACCCC
GTCATCATTGCCCTCTCTGCTCTGATGTCTTGCAATCCCCTGGCATCACCCCTGAGGTCC
AGTGGATCACTATTCCCAGGTGAGTAAATGATCACGATTTATGGATTGAATTTCCTTTAA
GGTATTCTTCAGTATTTTGAATGTCATGCGCCCAATGTCCCACCAGCAAGAACGACGCGT
GGCAACAGGATTCTTCTGCGAGCAAGCCTTTACTGTGTTACAGCTCTTCTTAGTGTTGCA
GCTCTTCTTAGTGTTAAACCTCTTCTCAGTGTTACAGCTCTTCTCAGTTTTACAGCTCTT
CTGAACAGGGACCCCGAGGAGCAAAATCGCTCAGCTTATAAAGACAACAGTATGCTAATT
ATCTCTCAGGGATTGGTGGGGCTTGGATCACCCCACTACTTGTTCTCCAGGGATTGGCGG
AGAATGAATCGTCTCATTAGCATATTAACGGTCAACTAACACCTGGTGCATAAACCGCAC
ATGTGCAGTACCGCTGTTCACCACTAGAGGGAGCCATAGCAAGGGGACAAGCCTGCACAT
GCGCAGTAAGTCGTTTATATCCAGACAAGGCTGGATGTCGGCGCCATCTTTGTTTCGCCG
TGCCGCTCTCTACATCTCCCCCTTTTTTGTTTAATAAAATGACTGGTCTAGATCTGGGTG
TCATGTCAATCTTGTCATTGCTCCTGTCTTAGGTCGTTCTCATCCAAACTCGTCCTTACC
CGTCATAGAGTTACCCTATNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNTNTCATT
TTGATCACATNNNNNTCACTGANTGCTNNNACTCAGGGATTCATGGCCANAATACTTGCG
GCTTTCTTCTGGGCATCTGATTCTCTTCAGCATTCACTTACCAGCTTGGGGACTGATTGT
TCCCACGCAGTATGGAAATGGGGAGTAATGAACACAGCCTAGCACATAAAATTTGAAACG
CACAAGTCTCTTGAAAATTTGATTAAAGTACATGTAACTGTTTGTGTGTTGTCCTCCCCA
TATTACTCAGGGAACTTCACCTTTATCTTGGTGTCTGACAATGTTTAGCAATTGAAAGAT
TTGCTCAGTGTAAATGATCAAGAGCATGTGTGATCCCCTTCCTCAATGGTTTATTTTTGG
GTACCTATTGACCTTAATGATCTCTTAGGGTAGTAACGTTCCATGTGTTGGGAATGTCAG
CATGGAAGTGGAAGTTGCAAGAGTGATTCTACTCAGTGGCATCATACATTAGACTTCTTA
AACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAGGGATACAATTGCCCTCACAT
CTTACTCTTTCCTTTTTAGAGAGGACAGTCTTCAAGTTCAAGCTACGTCTCCCCTTATTC
CACACAAGAGCGCTGTGCCCTTTTATCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGA
GGCACGGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACAGTTGT
GTCCTGCCTGTGTCTAGGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATGACATA
AAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGTTTACAAGCACT
ACTTTGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGCCCTTGTGC
TCTTTCCCCTCTGTGGGAACCTGGACAATCTTAGTGCAAGTGTGCTGGCAAACACTGCCT
GCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCTACCCCGTC
ATCATTGCCCTCTCTGCTCTGATGTCTTGCAATCCCCTGGCATCACCCCTGAGGTCCAGT
GGATCACTATTCCCAGGTGAGTGAAATGATCACAATTTATGGATTGAATTTCCTTTAAGG
TATTCTTCAGTATTTTGAATGTCATGCGTCCAATGTCTCACCAGCAAGAACGACGCGTGG
CAACAGGATTCTTCTGCGAGCAAGCCTTTACTGTGTTACAGCTCTTCTTAGTGTTGCAGC
TCTTCTTAGTGTTAAACCTCTTCTCAGTGTTACAGCTCTTCTCAGTTTTACAGCTCTTCT
GAACAGGGACCCCGAGGAGCAAAATCGCTCGGCTTATAAAGACAACAGTATGCTAATTAT
CTCTTAGGGATTGGTGGGGCTTGGATCACCCCACTACTTGTTCTCCAGGGATTGGCGGAG
AATGAATCGTCTCATTAGCATATTAACGGTCAACTAACACCTGGTGCATAAACCGCACAT
GTGCAGTACCGCTGTTCACCACTAGAGGGAGCCATAGCAAGGGGACAAGCCTGCACATGC
GCAGTAAGTCGTTTATATCCAGACAAGGCTGGATGTCGGCGCCATCTTTGTTTCGCCGTG
CCGCTCTCTACATCTCCCCCTTTTTTGTTTAATAAAATGACTGGTCTAGATCTGGGTGTC
ATGTCAATCTTGTCATTGCTCCTGTCTTAGGTCGTTCTCATCCAAACTCGTCCTTACCCG
TCATAGAGTTACCCTATCGCCACCAGGCCCCGTGTCTTAGGTTGGTCCGAGTTCGAGGAA
AGTTGCCCGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved