Rattus_norvegicus Locus Mono:37:SNORA70
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:37:SNORA70
Rattus_norvegicus
Mono:37:SNORA70
X
SNORA70
1001..1124
2124
GACCCGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTATATATAATAA
ATGAATAAATAAATCTTTAAAAAAATTTAAATTTAGAAATACCTAATTTTAATTTTCTTG
CTTGCTTGGTACTATCTGACTGACCAAAGGAAGACAGCTCGTATTGTTTGCTGTGGGGCC
TCAAGCTGACGGGCCTGTTTCCTGATGGCAAGAGGTTACTTCATATGTCTCTCTTGGACC
AGCAATCCATCAACCAGTGTTTGGCCTTTCCACAGCAGCTATAATATCCTGGACGCCTCT
GTGGCTCATAGTAACCAGAACCTGTTTGTTCTCTATGATTACCATATTCTCTAGAGTCAA
TGTACCTGTTATTTTGAGCTCTGAATCTTTTAGCCTTATAATTTCTTTGGAAATACCAAA
TTTACCACAATTAAAACATAAAGCATTTTGGTTTCTGAAATTTCTAGCTACAATTTGCCC
TATGATATTGGCATTATACTCCTGAGAACCAATACCAGTCGTTACCCTTATCCATTCATC
TATAGGGACTCTACATGTGCTTTCAATGGTCCGATTGCTCTCTTAGATATGAGGGCCTGG
GGCTGGAGAGATGGCTCAGCGGTTAAGAGCACCTGACTACTCTTCCAGAGGTCCTGAGTT
CAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAAAGAGATCTGATGCCCTCTT
CTGGTGTGTCTGAAGACAGCTACAGTGTACTTATATATAATAAATGAATAAATAAATAAA
AAGATATGAGGGCCTGGGATCACACACAAAAATATATGTAGAAGCCAGGTGGTAGTGACA
CATACCTTTAATCCAGCACTTTGGAGGCAGAGGCAGGCAGATCTCTGAGTTCAAAGCCAG
CCCAGCCTGGTCTACAGAATAAGTTCCCAGATAGGCAGGACTACATAGTGAGTGAGACCC
CATCTCAGTCTCACAAAAACCACCAAAACACACACACGCACATGAACAATTAAGCTGACT
TTCCTCATGGGAGCCTGCTGTGCAATGGTTGAAAACTGGCAGGCTCCTTGGGGGTGAATT
CACTGTTACCTATATGGATTGCCCGAAGGGAACTTGGAGACAATTTTCTGGCAGTTATTC
AAATATGTGATTTCCATGACATCCCCAATCTGGGGTTCAGACAGGTACATGTGATACCTT
ATGAAATCCCCAGGTCAGAGTGGCCAGGATTCACACTTGTGGAGTTTGATCAAATCCACC
TGGATCATGCTTTTGAATAAGGAAGATTTGTGGCTTCAGTAAGTTGAAGACGATTGAACT
GAAGACATGGTCACTGAGAAACAGCTCATTCCTGGTGGCTGTGGTGCCAAATATATCACC
AATCATGATCCCCTGGACAAGTGGCAGGCTCTGTCTTCTGGAGGGCTTCCACTGTGGTAC
TCTCCTATATACCACCAAATCATGTTCAGCAATAAATCTTGCATCCTGTCTGATTTAAAA
AAAAAAAACTAGAATAAGAAGATGAAGAAACTGGAAGCTAGCCATCAAGCTAGGCCTGGT
GGCACTCACTGGTAACCCTAGCATTCAAGAGGTAGGCAAGAGGGTCAAGGATCTTAAGTT
TTTGAGATTAGCTTGAGCTACACTGCTGGATCTTGCCTCAAGAAAAACACAAAACCAGTG
GGCTGGGGATCCAGCTCATTTGATAGAGTGCTTACCAACATGTCTACAGCCATTGGCTCC
ATCCTCATAAACTATGTAGTCATGTCTGCTGTGCAGTACTCTCTTCTGTGAGCCAGTCTT
TCTCTTAACTTCAGTGCTTAAAATCCATACTTAAATTCCTTCAATAAACTCCAACTCTGC
CAGGGATGGTATCAGATACCTTTTATCCCAGCACTTAGAAAGCAGAAGCAGGAGGATTTC
TGTGAGTTAGAGGCCAGCCTGAGCTACAGATTAACTCCCAGGCCAACCAGGACTATGCAG
TTGAGACCCTGTTTCCAAAAAGAACGTGCTGAATGTTGAGGCTAAAGAGATGACTCAGTC
GTTAAGAGCACTGGCTATTCTTGCAAAGGGCCTAGGTTCTTCTGTTCCTAGCACCCACGT
GGCAGCTCATAACTGTTTGTAACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved