Rattus_norvegicus Locus Mono:495:SNORA73
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:495:SNORA73
Rattus_norvegicus
Mono:495:SNORA73
14
SNORA73
1001..1179
2179
CACAGATGTGAAGACTGTCAGGGGACTTAGAGCAATCCACCGGTGGGGACACAGCTAAA
ACTGACCACAAAAACTAAATTTGGAGGACCAGAACACATGGCTTTGTCACGCTAGTGCTA
TTCTCTTTATTTCTGTGCACTTGTCAGAATTCCCATAATAAAATATTTCTTCAAAAATGA
ACTGTTTTGATACTGTTATGTTATAAAATATCAATTTCTCACAAAGACATTGATGAAAAA
TAAAATTTTGGCTGTCACATTTACTAGTGAATTAACTTACATCTTGCAGTCACGTAGACA
TCATCTTTATACAGTTACTGCAGGTTAGTGGGATCAGTGAGTGACCACAAAGTTAGAATT
CCAGGACCCAATCAGAAAAGTCTAACTCAGTAGTATCATTTCTAGGTCAGGGGGCACTCT
GAAGCCAGAAAGACCCAGGTTTGTGTCCTGACTCCACTGTCGTTTCTGCCAGCTCGACTG
TCTTCTCAGCAGATCATTAATTCCTGTGGACAATGGGCGCACATGCCCATAAAGAGGGGT
AGTAACACTCCTTGATGAGGACCGGAGAGATGGCTCAGCAGTTAAGAGCACTGACTGCTC
TTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTTAA
GAGACCTTGTTCCTTCTTATGGCCTGCAGGCATACATGGAGGCAGAACACTGTATACATT
AATAAATACATATTTCTAAAAATTGATTATATCCGAGATTCAAACAAAAACTATACCAAT
CAAGGTACATTACATCCTAATTTTTGCCTCAAGATAATTCTGAATAACTAATTTGCAACT
TAAAATGTCAATGTCTGAACAAACAATGTTTTTTCTTTTGAGACAGAGTCTCTTGTAGTC
TAGGTTGTCAAAGAACTTGGAGTGTAGGCAAAGATCAGCACCAACTCTGAAGGTCCTGCC
CACTCCTCCCAAATGCTGGGGTCGCAAGCAACACGGCCATGCCCAGGTAAAACAAAGTAT
TTCTAACACACGGGAGCATAGGGTACTGCCCGATGATGTACAGTCCCTTTCCACAACATT
GGAGATGAAGCGGGGCTTCGAGTCTGCGCCTGCATATTCCTACGACTTCTCAGAGTCCTG
TGGACCGTGACTGAGGAGACAAACCATGCAGGAAACAGTCTTAAATCGCAATCTGGGGGT
GGATCTGCGTACTTTAAGCGTTTAATTTACTGACGGAGTGTCAAAAAAAAAAAAAAGTAT
TTCTAACACATCATGAAGAAATACTGAGACAAATTCCTTTTGTAAAAAATGTTTATCAAT
TCTATTTTTGTATAAAACACAAGGGAGAGACCTGGCCAGTCAACACATGACTGACCACAG
GGAAAGGAGTTTATCAAACTTCGAGAGTCTAAAAACATACAAATGTGTCTTCTGTCTACA
GCAATTGTCTATGCTTTCCCACACACCGACTGGTACCCTCTGCCCAGTCACACACAGTGA
GGACAGCAGGTCAGTGACTCACGTCCTAAGCAGTTTTCTGCTGCCCCTTCTTTCCGATCA
GAGACTTGTGGATGTGCGGAATCACACCTACAACACAAGGTGTATGAGTTGTTATTTTTA
ATAACGTTCTTTAAATCTTAATGCCTTAATGCTAAAGTAAAAAGGCAATTAAACCAAGGA
CAGAACTTATTTAAGACTTTTCCCACTGGGATCCTACTGAACCTACAGGAACAGTAAGCG
AGGCTACCTAGAGCCATTGTGTCTGTAAGGTATGTTCAAACAGCTGAGAACTACCAACGC
ACTCGCACCTTACAGACTCCCAGTACAGAACCAGGTCGCTCCTGCCACGTCTATCGCATT
GAGCAATTGCTCAGGACCATGTTATTTCTCTAGCACAGTTCAAAATGTATGGGGAGATAT
TTTAAACCTTAGGTTTGAAGTATCGCATCATTTAAAGAGTGAGCTAAAATAAAAATAGTG
CTACACATGACAAGAGAACAAGTATTTACTCTGATCGCTATGACAAGAAGCATAGAGGGC
CCAGAACTGTAACTTAATTAGTGTTTAGCTGTAGCATTTATGAGGACCTAGGTTCACCCC
ATCACCACCAACAGAACTGTAGTACACTTAACACTTGTGGAGTTAAAATCCATATGGTTT
CTAGTTAACCATTCTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved