Rattus_norvegicus Locus Mono:568:SNORA19
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:568:SNORA19
Rattus_norvegicus
Mono:568:SNORA19
10
SNORA19
1001..1128
2132
AGTTGGGGCTGGGGGTCACATGCCTTTAGTCCCAGCACTTGAAGCAGAGGCAGGCATGG
AACCTGGTCTACATGGTGTGTTTCCAAAAGACTAGGGCAACGCATTGAGCTGTTAGCCCA
TTAAGATAAAGGATGGGGGGCTGGAGAGATGGCTCAGTGGGTAAGAGCACTGATGCTCTT
CCAGAGGTCCCAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGG
GATCTGATGCCCTCTTCTGGTGTGCCTGAAGACAGCTACAGTGTACACATATACATAAAA
TAAATTTAAAAAAAAAAGATAAAGGATAGGGGAGGCCTTGGACGGGTTTGGTTCCCAGCA
TGCATTGGGTACTCACAACTAATTCTGGTTTGGCAAATTAGACTGACACCCTTCTCTGGC
CTCTGAAGGCCAAACAAGCATTGTACACAAAAAAAATCAGTGCACAAGACAGGGACTTAG
ATCTGAAGAAAAAATTAAGATTTTTTTTTTTTTAAGATTTTATGAGAGTACACTGTAGCT
GTTCTCAGACACACCAGAAGAGGGCATCATATTTCATTCCAGATGGTTGTGAGCCACCAT
GTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAAAGCAGTCAGCGCTCTTACAGGGAC
TTAGATCTGAAGAAAAAATTAAGATTTTTTTTTTTTTAAGATTTTATGAGAGTACACTGT
AGCTGTTCTCAGACACACCAGAAGAGGGCATCATATTTCATTCCAGATGGTTGTGAGCCA
CCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAAAGCAGTCAGCGCTCTTAACC
TCTGAGCCATCTCTCCAGCCCCCCCCTTTTTTTTTTCTTCCCAGAGCTGAGGACCAAACC
CAGGGCCTTTCGCTTCCTAGGTAAGTGCTCTACCACTGAGCTAAATCCCCAGCCCCAGAA
CTCCTGTCTCTTAAATGCTGAGATTAAAGTTATGTATCACACTGCACATTTCATTGACCT
GCTTTCCTTTGACTGTGTGAGCAGTGTTAATTCTTATGTGCTATACTAATAGTTGAAGGT
TCATTAGCAGAGTAACTGCATATAGTAATTCTGCCAGTCCCCTTCAGACAAAAAAAAAAA
AAAAGGTATCACCACACCCGGTCTGGTTTTTAATTAAATACATTTTATTGTGTGTATACA
TTTATTGTGCGTGTGCTGCAGTGTACCTGTCAGGGCAACTGGCCAGAGTTAGTTTTGAGT
TCGTTTTCTTTCCTGTGTAGGTTCCTGGAATCAAACTCAAGGCCTTTGCAGCAAGTGTCC
TTACCTGCTAAGCCATCTCACTGGTCCATTATTTTCATGAGAAAGTGGCCAGACATAGTT
GAATGCACCTGCAGTCCTAGCACTCAAAGCAGGTGGATCTGATCTACATAGGATGCAAAT
TTTAGGACTGCCAGGATCATACCATACACCCTATGGGGGTAGGGAGTGGGCGGGAGGGCG
TAGAGTTGGCCTTGGCTCATGTTTGAAATGATGTTTGAGTTCAGTCAGGATCGGGCCTGG
GCTATATGGTGATAATCTTACCACCCTCTAAAAATGATCACTGGTGTAATTTTAAATTTG
AGGTGAGAATTAGGTCTGTAGTAGAATACTTAGAACAGGAGGGCCTGCCTAGGTTTGAGC
CTCTGTGTTGACTAAACAATGGAGATTTAGACCCAAGAATTTAGAGCATCCTGGTTGATG
CTGTACCGGGCAACCTGAGATACAGTAAAATCCTGTCTCATCTCAAACAGTCTCCTGTAT
TCCAGGCTGGCCTTTGTGTAATTTACTATGTAGCCAATGATGACCACAAATGAACCTTTT
GTTGTCTTCCTATAGAGCATCATGGATTAAACTATACTGTAGACCGTGGTACTGGTCTAA
AGCAGCCTGGGTATTGAATCCAATACTTAATAAATGCCAGTGTAACTATCAACTAATCTA
CATTCCTAGCCTTTCTATCTGCTGTTCATGTATATTTCTTAGGAGGCCTGGATGGCCTGG
ATAATACTGTGTAGAGCAGCTGCCCTTGAACTAAGACTGCCTGATGTGTGACAAAACTTC
TGGGGAGACCCACAATAGACCAAGTATGGAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_005109
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved