Rattus_norvegicus Locus Poly:5:SNORD48
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:5:SNORD48
Rattus_norvegicus
Poly:5:SNORD48
20
SNORD48, SNORD52
1001..1064, 2130..2195
3195
CAAAGAGCGAATCTACCCTGCAGGATCTCCAGGGTCTTTACCCAACCTTGGTGTTTAGG
CTGCCTGTTTCGCTTGTTTATTTTTTTTTCCTTTACTTTGGCTTGGTCGTTTATCAAATT
GTCGTCACATACACGATTCTCCACCCAGGACAGTGAGAAACATAATTCCTCTTTGTTCCC
TTCGCATTCGTCAGCGCGAGCAAGTCAGGCATAGGAGAAGACGACTATGTCCGTCAGGAC
CCCCGCGCGGGTATAAAGGACGGAGGCGGGCGGCTGCTGGTCTCTTTGTGCGCCTGCTCT
CATGGCTTCTTTTTCTTCCCCTCTCTGCTGTTCCCCACCGATCTCTGCGGAGTCTATGGA
CTCTGGGGGACAAGACGCGGGTCGCCCTAGTGCAGCAGGTATCCTGGTGCCCTGTCTGGG
GTGGGGGTGTCTCTGCGGTGTGGGGCCGGGTAGGATGACTCACATTTACAGACTAGAGTT
TCTGATGTCCACGTGACGCCACCCCTTGTAACTGACCCAGCCCAGGGTGGGGGAGTGCTG
GCCCGATTCTCTCGGATCTGTGCTCACTCAGTGGTCTCTTCCAGGCTCCTGACCTTCGCC
AACCAGCAGGACCTGGCTCCCTGGTCTTCTCTCCTCCACTGCTCCCCCCCACCCCCGATC
TCTCCGGCGTCTGTGGACTCCGGAAGGCGAGACGCGGGTCGGCCTGGTACAGCAGGTATC
CTGGGGTCCTGGGGGGGGGGTTGTCTCTGCGGTGTGGGGCCGGGTAGGATGACCCACATT
TACAGACTAGAGTTTCTGATGTCCACGTGACGCCACCCCTTCTAACTGACCCAGCCCGGG
GTGGGGGGCTGCTGGACCCAGTCTCTTGGATGTGGGCTCACTCAGTGGTCTCTTCCAGGC
GCCTGACCTTCGCCTGCGGGACCCAGGAGCACAATGAATGGTAAGCGGATGGCACGAGTG
GTGGGCGGTGTGAGGAGGGGCTGGCACCGGGGAAAAAGGACGGTAATGATGACTTCTGGT
GATTCTGAGTGTCTTCGCTGACGCCATCACCGCAGCGCGCTGACCGTCCCCGCGTCCAAA
ATCTGCAGTATTGGGGTTTGAGCTTTCGTCCCCTGGAGTTAATAGTGATGGGCTTCTGTG
TCTTTCCATTAGGGCTTTGCCGACACTCGCTGGCTGCCTATGCTCGAAGGAAGGTTAGTA
TTAGTGTCCAAAAGACGTTTTTCTTGGGTTTCTGCTCCCTTACTTGACTTGTTGTGGGGG
AGGGGTTGCAGACAGGGTTTTCCATGTAGCCCTGGTTGCCCTGATCCTTCATCCACTTGT
CTGTGCTTTCGACTGGCGTGCACCCCCCACCCCACCCCGCCCTGCCCATGGCTTTGTCCT
TAAGATAGGGCAGGCCTTAGCCAGTCTCCAGGCAAGCCACCATGGCGCCCATCTTGCTTT
TTTAGATAGCAACTAATCTAAACTAGTTAACGAATCTAGTTAACTAAACTAGGGTGGTAA
GTTAATATCCACGAGCCACCTTGGTCATTTTCTTGTCCTTTTAATCTTTGTATGCCAATA
GAGTGGCACTAAACAGTAGTTCTCAGCCTTCCTGACCCTGCAAACCTTTTTTTTTTTTTT
TTTGGTTCTTTTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGTAAGCG
CTCTACCACTGAGCTAAATCCCCAGCCCCCCCTGCAAACCTTTAATACAGTTCCTCGTGT
TATGTTCCCAACCATCAAAGTTATTTCGTTGCTTCTTCATATCTAGTCTTTGGTGCTGAT
GCGATATGCAGGGTGTCCTATCTGGGAGCCCTGTGTAAAGCTCCCTTGGTGACTAAGGGT
GGAGAGCCACTGCTCTAGACCATGTTTTGGGGTATTCAGACGGGCTCATTCAGTCCAGGA
TGGCTTTAGTCCTAGTGCTTGGCTTGGGGTTGTGTCACTTTTTCGTTATGATTTTAGGTT
CTATTTCAGTCTCCAGAGTGGTTTTGGGTTTTTGCAGCTCTGTAACAGTCTAAACCTAAC
AGTACAGACACGGGCTACCACACCCTGTTCTTACTGTCTCTCTGGATTAACATCCCTGGA
TGCTGCCCTTGGTTTGGGTCTCCCTCAATTGAGAATGATGATTTCACAGACTAGAGTCTC
TGACTCTGCCCTTGATGTCAACTATAAATCTGACTCATTTGGGGAACCTGAATTCTTACT
CCTCTTCCTTGAGATGGAACCATGTTCCAGCACTGGCTCTATTGAGGTACATGCCCTGTT
CCTGCTTCTCATCGATTGTCTTAATTAACTCTTCCAGGGCGATGTCTGAAGGCCGCCCAG
GGGCCCCATCCCCTCACCTAGATGTGGGCTAACCTAGGACCCAGACTAAGGTGGAGTTCC
TACAAGTGACTAGAATGTCATGATCATCTCATTGTCTAACAAGCCCTTTGTCCTCTGTGC
TGGGAAGGTGAGTGCTGTGCTGTGGTTAATTCACTGTAATAAAGCGTGACTAAGAGCCTG
GGGGAGGAGGGGGCTGTTGAAGGCTTTGTCTTATGAGATGCCAGTCACTGGGGCCTGTAA
AGTTAACAAGCACAATGAAGTCATCACTTGCGGGTTGTAATGCTGACTGTTGCTGACCTT
GTTAAAATGTCCTGGATTTGAAGCACATAGCCCAGCTTTGTGTGGTCCTGAAATACATTC
TTCTTAATTTTCAGGCCTTAGCTGCTACTCAAAACTGACAAGTTGGACTCCTTTTTACTA
CTGCCTTGTTGCCAGCTATCCGAGCGTGAAAGGCCGCAAAGCCGTGGGTGCTGGCTGTCC
CACATCACAGGCATGGCAGGTGGCAGCCCAGACTGAACCAGAGCCTCACTTGAACATGAG
CATTAGCCAATGTAATAAAAGCCTACCTTGCCTGAAGTGTATCTGTTTTTCTGCTTACAA
TGGCTTGCAATGGAAGTGCATGGTTTCCTGCTTCTAATAAAATCCTTTAAAAGCACTTAA
TTTGACTGTTGGTGTCACTCTTTGGGGGGATATGAAAAGATTTTAACTGCCACAGAAGGG
TCTGGTCTGTTCCCCCACTGCCTGCGTACATCAAATGCCCAGGAGCTAAGACCTCTGCAG
GAGCAGCTGTTGATCTGTCACTTCATGGTGTCTGGGTCAGGCTCCCTTAACTTAGCCCTG
TTACCTGCTGTCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved