Rattus_norvegicus Locus Mono:98:SNORA43
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:98:SNORA43
Rattus_norvegicus
Mono:98:SNORA43
8
SNORA43
1001..1138
2138
TTCCTGTTCAAACTGGGACTCAACTCAACTCTGTTTTGGTTACAGAGACTTAGTCCTAG
GGCTCACGAGTCCAGGCACTCACAGCCCTCCACCTGCCTCTGCCACCTCAGTGCTGGAAC
CAGAGGTGTGTGTTACCATGCCTGGCGACGGGTGTCTTGTCTTTACTTCTCTGCAGCTCT
CTCAGCACTCCGAGCCCAGAGGAGAGTTCATTTTCACGAGTCCTGTACAACATGTACTGG
GTGGGTCTGCTCTAAGGGCTCGAGTGTTTGTTTTTTTTTTTAAAGATTTATTTATTCATT
TATTATATATAAGTACACTGTAGCTGTCCTCAGACACACCAGAAGAGGGCATCGGATCTC
TTTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGTGCTCTGGAA
GAGCAGTCAGTGTGCTCTTAACCGCTGAGCCATCTGTCCAACCCTCGAGTGTGTGTTTTG
AACAAACAAAAACACCATGTTAAATCCACTATTGCTTCTCTGTATGCCAGTCCCATTTTT
TTTTTGTTTGTTTGTTTTTAAGATAGTGTCTTATGATGCTGCCCAGAAATATCCAGAAAA
AAAGCAGAGGCAATTTGGAGTTCATAACCCATGAGGTAACATGTCTGAAGGAATAGGGGA
ACTGCCCTCGAGTAGTATAGATAACCGGGAGTGAAAAAACCATATTTCTCTACAGGTAAA
AATGACAACAAATCAAAAACCTCAACCATCTAGGCTTTGAACCTGTCATGCATCTAAAGC
ACGAGGGCCAGGGAGATGGCTCAGTGGGTAGGTACTTGTCATACAAGCCTTATGGCTTGA
GCTCAACCACTGGAATCCACATAAAGCTGGAAGGAAAGAACAAACCCCACAATTTATTTT
TTGAGCTCCACAGTCTGCCATGGTGTATGCATACCCCCCACCCCCACGTATATGTATACC
ATGTCAGTTTTTGAAAAAACAAAAACGGCAGCCTTCCGGATGCTGTTCTGGATCTGTCAG
CACTGCAGGTACAGCGGCTGGGCTCTGTCTATGACACTGGGGCAAAGAGCAAGTGACTAT
TTCTATACTCAGCTTTCAGAAGCCAGTCAGCACTGAGAATGGTATATAGCCTGACATTCC
ATGGGGTTGAGGGGTGAAGGGAACAGGCATGGTGTCTGTCACATGTCTTTAATTCCGGCA
TCAGGGAGGCAGGTGTACCACATGTCACTCAGCTTGGGTTCTGGAACTCTGACTAGGAGC
AGGGTAGGAAGGAAGATAGATTTACAGTAGACTTAGGTACAGGAAAGCTGTTTTAGGTAC
AGCACAGGGCGTGGGGGTGAGGATGGGTTGGCTAGTCTCGGAAGGATATCAGGGGAAGCA
GCAGTTGCTACCCTTTGCACACACTGACCACGGTTCATACACACTTATACTTGGTCCCTT
GAGGAAAGCTTTGGCATTTCTTTGGAGCTTCACCCAGATAAGGCTTTGACACTTCCACAG
GTCTGAGGCCTTGGAGTCCTTGCCTGTGTCAACAGAGTACATTTGCTCAGACTTCTTCCA
TTCCCTGCACAGGGGATCTAAGTTCAAGGTCAGTCTGGCCTACCATAGAGACACCCTGTC
TCAGAGTCGAAAGGGCTGGGGAATGTGGCTTGGTGATTAAGGCACCTAAGTAGCTTGACT
GAGATTCTGGGGTAATCTCTGGTCTGCAAATAAGGGAGGGTGGTGGAGGAAAGAGGCAGG
AGTGACAAGGGGAAGACTGGAGTCTAACCAGACTTCATTTGTTGAAAGTCTGCAAGTGTA
GTTCAGTAACGAAGTGTATGCTGAGGGTTACCACAGAGAAATAAAAATCAGGGAAGTCTC
TCTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTCGGAGCTGGGGACCGAACCC
AGGGCCTTGCGCTTCCTAGGTAAGCACTCTACCACTGAGCTAAATCCCCAGCCCCCAGGG
AAGTCTCTTAATGTGACATCCCCAACTTTTTAAAAAATGAGTGTGTGTGTGTGTGTGTGT
GCGTGTGCGCGTGCGCGCGCGCGCGCGCGCGCGCGCATACAGAGAACAGGTGCCGAGGAG
AGGGTGTCAGATCCCAGACTTGGAGTCAGAGATAATTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved