Rattus_norvegicus Locus Mono:60:SNORA42
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:60:SNORA42
Rattus_norvegicus
Mono:60:SNORA42
8
SNORA42
1001..1131
2131
TGATGGAGGAGGTAAGGGGAAAGTGCATGGGTCGGGGAGGAGGTATGAGACATGGAACT
CTCATGGGGTGGATTGGGAGGGTAATAGTATCTGGAGTGTAAAAAAAAGAAAGAAAAGCA
GAGATTGGAAATCCCTGAGTTAAAATTCTACCTGATCTACATACAAAGTGAGTTCAAGGG
CATCCAAGTTTAGGATGCAAAGGAAACCATCAAAAATGTACCAGCCCCAAGAGGCAGCAG
AATGTAGCAGTTTTGGCCACATGATTCTGGCTTTAGAGTCAGTGATAAAAAGAAAACCGT
CATGGAATCTCTGTCTATGACTAACGAAATCCACTGATGCCAGACATATATCAGGGGTGT
CTCTGCATGGAGGCCTAGAAATGGTGTTGCATAAAGCTCTGAAGATTAATCTTGGGTTGT
GTGATGGTTTGCATATACTTGGCCCAGGGAGTGGCACTATTAGAAGGTGTTGCCTTGTTG
GAGGAAGTGTGTCACTGTGGACATGCACTTGGAGACCCTCCTCATAACTGCCTGATGATG
CTCAGTCTGTTCCTGATCTTCTTTGTGGGAAGATGTATAACTCAGTTCCTCCTGCACCAT
GACTTCCTGATGCTGCCACGTTCCCACCTTGATGATAATGGACTGAACCTCTGAACCTGT
AAGCCAGCCCCAATTAAATGATGTCCTTTATAAAATTTGAGTTGGTCATGGTATCTGTTC
ACAGCAATAAATGCATAACACAGGTTGCCTTGGAGATGCTAAGATGCTAGATATGCTAGA
GACATAGGATACTTTCCAAGGAAAGCTGCTAAGCAGAAGGAGAACCAGCCCAGAACAGAG
AACTCTATGGCAGTCAACAAAGCTGAAAGGAATTGGAGATCAAAACCATTTTGACATCAG
ACATGGAGATGTAGAGGTTAGAGTTTGCCCAGAATGTTTTGGTCTTTCTTTGGTCCAGTA
CTTTCTCACTATTCTTCCTTTCCTCCCTTTGAAAAGTTACAGTATATATTCTACAACTGT
ATAAATAGAAGTGGGTCCTCTCATAGTGTCCCATGCTAGAGCATACTGGCTCCTAACCAT
TGCCCAGCCTTGGTGCATGTAGGTTGCTGGCACTGAAGTGGGTCACACAGTGGAAAAAAA
GAAGTGTGTGATATTCTCTTGATTTATATTTTACAGGTGATTATACATGAGAGATTGGAT
GATCTCAGAAGAGACTTTGAACTTTGGAGTTTTAAACATTGTTGAGACTCTAATAGACTA
TGGATTGCTTTCGAAGTTGATAGGATGCAATTCTACATTATAATATGGTTATGAACTTAT
GGAGCAGGGGAGTAGAATGTGGTGGTTTAAATCAAAATGACCCATATTTTAGATATGTCT
TCCAACCTCAAAATTTGGATTAAAGATGTCTATCTTCCCTTCTCAAGATCCAAATTAAAG
GCTTATGTAACCATCTATGATAGGCATATATGACAGAACCTCTCATGGTAACCAAGGAGC
AAGGAGAGAATGCCTAATTGACTTTCTCATTTTACCCTTCTATTAGACCCAGATTTCTTC
TCTAATGCATGGTGCCACCTATAATCAGCATGGGTCTGTTCTTACTGGAAATTCACCAAT
GACACATCCAGAGATGTTCTTCAATAAAAATTTTGGTGATCCTTTAAAATGTCTATTTTA
ACCCTAATTTTTAAGTTTTATGCAGTAAATTATCAAAACTTTTGCACCTAAGTCAAGCTA
TGTTGATTATTAAAATTAACCATGACAACTAGTCTTGAAACCAAAACACAGAAGTCAAAC
TCACCTGGCTTTCATATTAGGCACATAGGATTTTGAAATATAACATCAATTCTTATAGGC
TTTTTGGGTCACAAGAAAGTAGAGAAAGTTTGTGGTGTCTGTTTGCTGCATTAGAGCTAT
AAAGATACCTTAGGATTATGTAGTGAAGATCAGAGATAGTACATACATTTATATCTTGTT
GGTTATCATAAGAAGAAATCCAAGGGTTTTTTTTACACAAGTGATGTCTGAAAGTATCTC
TAGTTTTCAGAGCTTCCAGTCATGTGGAAACAGAATAGAAGTATTTTTTTTAACTTGTCT
TTATTTAGATTTATAATTCACTTGTTATAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved