Rattus_norvegicus Locus Mono:56:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:56:SNORA44
Rattus_norvegicus
Mono:56:SNORA44
9
SNORA44
1001..1111
2111
AGCTGTGGCTAGGAATGCTCAATGGATAGGACAGGTAAACCATAGTTCAGCAGAGCTCC
CTAGTCTATCTTTGGCCAGGGTCTAGACTGGGTCTGGAGGAAAGCCAGTGCATGCATAGG
TATGGCTAGTTCTGAGGTACAGTACAGTAAGGGCGTGTCCAGCTCAGGTCCACCGCCCTG
AACCTGTGTCTCACAGCACAGGGCTCACTCTACCATTTTCTAGCTTTTGGTCTGATCTTT
ACTTGTACCACCCAAAAGTCCTGAATTAGCATAGGTGAATCCCTGGCAGAGCTCCTTTGT
ATACAGAGCCAGCTTCCAGAGAGGGACTCAGGCCCAGAAACTTGGCTACAGAACCAGCCT
CTGGGACAGGAACTCCAAAGCACAGCAAAAAACTCACTGGTACAGGACAGTGATCATCCT
ACAGGCCTGTCCAGAGGTGCAATGCAGCATCAAGACCTGGAAGCACAGCTAAGGGACAGA
CTATGAACTTTTAAAAACAGCGAGAAGGGGCCATGATGGCATTGGGTCAGGAAGCTGCTA
TGGAGGAGCTGTGAGGGGTGGCCACATAAAACACAGAAAATGCTAAGACTTTGGGGTTAA
ATTGCTTTTGCAGAGGCACAGATATGTGAGTCTATGGCCCATGTTGAGAATAAGGCAGCA
GCCTGGTGAGGTGGCACTCAGTCAGCTGGCACATCAGGGTCACTGGGTGCCATTGCCTAA
AATGACTTCTACGCTTTCCTGCTGGCACGTGGCCAGTGCCTGAGGCCAGCCTGAAACACC
TAGCTCCTAGTCCTGGAAAATGGGTGCCATGGGAGGTGGGCATGGCCAGCTTCAGCAAAG
TGCTGGACAATTGTCAGCGAGGCTTTCTTTCCTAGGTCAGTTGTTGCCCTCTCCCACCAG
GCAGAAAGGACTCAAGGATGAAGAGCCTGGTCCTGGTAGAGTGAGTCCTTAACTAGCCCA
CTCCACACCTAAGAGCATGGAGAGCAATGGCCCCACATCCCCGGACACTTAAGAGAGCAA
CCACCCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAGCCCAGGTTATCACAGT
GCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTATGAGCTGCCTGT
CCTTCTGTCCTGTGGTATTCAAAACAAACTTTCCTTCTGCAGTGTGCACTTGGGCGGTTC
TTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACCTAAGGACCATGTGACC
AGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGAAAAATGCCACAAGAAG
ATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCCTTTTGTGGCCAG
ATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACCTTTGTAACCTAACATG
CAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAAAAAGAGAGAGCAACCACCA
CAATACCAACGCCCCCAGCCTTCTTATAGGCAGCTCTTAGAGCCCAGAGTGAGGCTTCTA
GATCCTCTTTTCTCACAAGGCCCAAGCAGGACAATGTTCTCAGCACACACATTCCTGAAA
GGGAACCTAGAGCTGCTCTCGGGCCTGTTCACCAGGGCAGGCAGAGCTCTGCTATCTAAA
CCAGGGAAGAACCTTGTGTAGCCCTTCAGCAATCCCCAGTACAGGACACTCCCATGGCTT
ATGAGACTGGTCTAGTGACGGCAGCATGGTAGAGTGGTTAGTACTAATCCAAGTCCAGGG
GTCCTAGATGCTGGGACTCTATCTTGGTCCTGTTCTCTTGGGTGGGCAAGGTGGCTCTGG
GAAAGTTGCTCCTGTGGAGTGGCTAGACTAGGACAGAGATGTCTGACTACACCCTCCAGG
TAGGCCTCAGATGAGAATACCCTGACCAACACAGTGCAATCACATGACACTCAGGGCAGG
ACCCAGTGGCTGCTCCTGAATCCCTTACCCATAGAGAACACTGTTTGTTGTTGAAGCTAT
GATGTATGGCATGACTCTCTTACACAGCTGTGAGCAACTTGAACAGCTCGTGTGGGACGC
TTTTTGCTTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved