Rattus_norvegicus Locus Mono:274:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:274:SNORA44
Rattus_norvegicus
Mono:274:SNORA44
20
SNORA44
1001..1116
2116
AGTTTTCTTTTTTAAAAAATATTTAGTTCTATGAAGTATATTGTGCTCTTTTTTTTTTT
TGAGGTGTGAGGTGTAACTGAAGCACCTGCCCCACTGCAACCCCCCAACTCCCCCAGGGC
CACAGCCCACACTCCCCTTGCTCCACCAGCAATGTCTCCTCTAGCAGATATCTACTCCTT
TGTCCCAAGCATATGTGTGAGGTCTGTTCTGAGTCCTCAGCTGTTCCTTATTGACCCACG
AGTCTGCCCATCCGCTACTGCTGCACTGGCCCCAGAACAGACCCCACCAATAGCAGCCAA
CCTAAACATCAGGACCTCTTCCCATGCCTTCTATTTTTAAGATTGTTTTGGCTCTTCTGT
GGCCAGCATCTCTCCAAGTAGATCCCAAAATAAGCTTATTCATGGCTACCCAAACCCCAC
AGGAACTGAATCCATCTGGGGAGAGCTGACGTCTCTCCTGTCCAGAGCCTTGGTTTTCTG
TTTGTTTTGTTGTTGTTTTGTTATTTCTGTTTTGCAGCAGGTCTTGTCTATAGTTCATGT
TTTTCTTCTTGTGTCTTGAATGTTTCTGCACATTCTCTGGCACTGTTAGAAGAGTAGTTG
GCTTTTGTGACCTGGCTAAACTCTTTTATCTTTAGCTCTTTTTAGATTCCGTGGAATTTG
ATCTTATTTTTGGTTCTAGAGATCAAACCCAGGACCTTGATTGAGGGTACATACTAATTA
TGTGGTACTCTACTCCAGAGCTGTACCCTTACCTCCTGGAGACCTTATATGGGTGTGGTC
ATGACATCTGCAAATGAATGTATTTATTCTCGTGTGTGTATTTCTTTTACTTATATAACT
ACTGTCTCTACCACTATACTGGATAGGTATAAGCACCCCCTGTTTATTCTCAATCTTGGG
ATAAAAGCGTCCAGCCTTTTGCCAGTAAATATGACATCACAGCAGACATTTTGGGGATGC
TCTTTCTCAAGGTGAGGTCATTGGCTTCCATAGCTACGATCTAGGAGATTTTTAAAGTCA
AGTTAAAGTTAGTTGGTTTTCTGCCAGAGTAACGGAGAGACTTTGACAGCCCAGGTTATC
ACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTATGAGCTG
TCTGTCCTTCTGTCCTGTGGTATTCAACAACAAACTTTCCTTCTGCAGTGTGCACTTGGG
CAGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAAGCTAAGGACCAT
GTGACCAGTGAGGTGGCCATCATGTGATTTGGTCTGCATTATTTGTTGGAAAAATGCCAC
AAGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCCTTTTGT
GGCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACCTTTGTAACCT
AACATGCAATTGGTTCAAAAAGACTTCAAATTTCAAAAAAAAAAAAAAGTTAGTTGGTTT
TCCTACTTAAATCGATATGATCATTTTTAGAGTTATAGCAACCTTGCATAAATTAGAAGA
AATCCTAATTGACTTCACATATAGTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTCGGA
GCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGTAAGCGCTCTACCACTGAGCCAAA
TCCCCAGCCCTAGTTTTTTAAATATACATTGTTGACTTAGGTTCCTGGCATTTTATTGAA
GAGGTTTGTGTCTAAGTTCATGACTGCCGCTGTTCTGTTGCTTTACTTGTGTGTGTTGGC
TTTGTCTGGCCTAGGTGGGTGATTGGATGAAAATGATCTCATAAACGAGTTAACAAGTAT
TCACCATTCTCTTGTTTCCCAGAGAAATTGTGTGAAATTAGTGTTAATTTTCAAAAACTG
GACCTAGAAATCCAACTAGGAATTAAAATTTTCTGAGGATCACAGGGAGCAAATTTTCAC
CTTAATTGAGTTTGGCAGTTTGTAATTTTTGAGGAATTGGTCTGTGTCTTTTTGATGACT
ATATCATGAGCAAAACAAGTCCTTTTTTTTTCTGATCCCTTAGATGGCTGTTGAGTCTGT
AGTAATGTCTATTGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved