Rattus_norvegicus Locus Mono:611:SNORD25
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:611:SNORD25
Rattus_norvegicus
Mono:611:SNORD25
1
SNORD25
1001..1070
2070
GCCAAGATCATGGCGAAAATAGACCATAAAGCAAAACAAACAAACAACAACAACAAAAA
AAAATCGGTCTCCAGAATGACGCAGGGGATCTAGTCCTGACTGTGTTTCCCTAAAAGGCT
CCATGCAAGGAAGCGAAAATCTAACCGAGCTCAACCCAGGGCCCAGTACCTGAGTCGCCA
GCTGCGCTGACAACCTGGACATCAAGCCCCGTCTGCGCGCTGGGCGGCTGGCGGGGAACC
GAGCCGCCGCCGGTGGAGTGTTCAGTAGGTTCGGGATCCATAGAGATGGATCGACACGCG
GGCTTAGTGTGAGTAAGGGCAAGAAATCACGTCAACGTGTGGATATATTTGGTGGTTGTG
ACCCAGACTGTCGAGATGTAACGGTCGGGAAGCCAAACCTCCAACGATGACGTCTCATCC
GCAGTGGGTAGGAACCGCCTAGTAGCAGCCGCCGCACTCCCCTAGAGCGCCTGCGCCTCT
TTTTCCGCGCTGCAAAATAGGCGGCGGAACACTCCACACGCGCCTTTGGGCGGAATCCTC
TACCCACAATTCCTCCGGCTCGCCCAACGCTTACCTTAGCGCCTGCGTCCCTCCTAGTCC
CACCTCCAAATCCCGTGGGCCTCTGCGACACGCTATTTATAGGCCACACGTTGTTCTTTT
CGGTCTCATTTTCCTTTGCTCTGGGTAAGTCTTCTTCGTGGGCTGTGATTGGTTTTTTTC
TAACCTTTTTTTCCCTCCCCTCTCTCTTAACCAGCCTAGCTATAACTGCGGCTGGCTTCT
ATCAGAAGGATCTACCTGCCTATGTTGTGAACCACCGCTTGTATATTTCTTATGAGATGT
TTGTTTCTGGTGGTTTAAGAGACGCCCGTGGATATAGCGTTCGTAGACGTGGACTTCAGT
AATGCTCTCCATAGTCATAGTGGGGAGGCCATGTTGGGGCGTTCAGGATCTAGAGAGGCA
GGGTTATGTGAAGGACAAAATGGTGGCGGCAGTGCGAGGCCATGCCCTATGATGAGGACC
TTTTCACAGACCTGTACTGATCTCTGTGAGGATAAGTAACTCTGAGGAGGCTGGCCCCGG
ACCTACGGCCTTCTGACCCTGCAGAGGTTGTGATGTAAAAGCGGTGTAGGAATAACCCGA
TGCTGTTTGCTCTTACAGGTTTAAGGTACTCTTTTACATGCGAAAGAATGGGAGCACGCT
CTCATTTCAAAGTAAGTGTTAATAACTTTACTAGGGGTTTCTTCTTTATTTCTTTTAGTT
GAGCATAAGTTATGAACGTGCTACGGGGATGATTTAGAAGCTGAACTCTCTCTTTCTGAT
GGTTTAGTGGAGAAATCAAAAATACTCTGAGTAGCACAATCTGTAGCAGGTATTTGGACA
GTTGAGTAAATTCTGATATTGAAGTTGGGTTTTTATTTCTGTTCCAGATATGGCTAATGT
CAAAGCCGTTTGCACTTTGGAGCCAGGCCTGTTCAATTTTACAAATAGCAAGTTTTTCTT
ACAATCAGGTGAGTATCCGTGGCTTGTGCTTTCCTTGGGAGCACATTTAGATGTCCACTT
GATGATGAATGTATTATAAATGACAAGCATATGGCTGAACTTAGGTGATGTCATCTTACT
GCTGAAAAGTGGGCTGAAAACAGAAGGGGCTTAGGTAGCTGTGATTGCATTAAAAAGTGA
CATTGTTTTTCTATGTTAAGGGTACGGTGGCAACGTGACTTGAAACCCCCAGAATCATAC
CCGGGATGAATGCAGGTAATAGTCCAGATGGAGCTTGGGCTTTCTCTTTGGGTAAATAGT
TGGAGAAACGCTGAAGTGGCACACTATCTTTGCTGCTTATGGATTCTGCATATCTCTATA
TTTAGGCTTTGCTCACTCAACTCACTGTCAGATGATTTGAATTGATACACTGATAACTCC
GTGAAGGTGTGAATTTATTATAGCATGTTAGAGTTCTGATGGCAGTTGATGGTAAGGAAT
AGGTATCTGTTCTGTCCTGACCATTGAAAGTAACAAGTTTTTTTTTTTATTCCCCAGGTT
TTCTTGGTGGTGATTATCTTAAAGGTAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved