Rattus_norvegicus Locus Mono:545:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:545:SNORA44
Rattus_norvegicus
Mono:545:SNORA44
10
SNORA44
1001..1106
2106
GTCACCATTTCTTCCACTGGAGACGGGGTCTTACATAGGCCAGGTTGGACTTGAACTTA
CTATCCTGCTGCCGCTCAGCCTCCACACTGTCGAGATTATCAGCATACGCCATTACACTT
GGTCCATTTCTTCATTTAGTATCTATAAAACTATATTGCTTTTTTCAGTGAAAGTTGAAA
TGCTAAATCATATTAATTACATGCTTTCTAAAATGGGCAGGTGCTAATGTATAACTTTTG
TTTCCCCACAGCGCATGGATTTAGGAGAATGTACCAAAATCCACAACTTGGCCCTTCGAG
CAGATTATGAAATTGCAAGTAAAGAAAGAGACCTGTTTTTTTTAATTAGATGTAAGATTC
TTTTGGATGTTGACTTATCAGTGCTGCAAAGTAGCAATTGCTATTGAGAGTAATGTTATG
TTTTTAGGTTACAAAGCAAAATAATGAAATATGCACTTTTTAATGTATATTTAAAACTGG
GCAGGGGTGGTTCATGTCCGAAATCTGGGGAAGTAGGTGTTGCATCTATAAAGTTCAAGG
CAAGGGATTTCTTTTCCTGCTGGGAGGAAAAGATCACACTGTGATGGTAGACTTTCGTGA
CAAAGCTGCTTGCTCTATATAAATTGTAAAATGTCCTACCATGAGACTAGACAGTTTTGA
GGATCTAGCCCATGTGTTTATTAAATAGTTCTCCTTTCTCTCTGAACGCTTCTGTGCTCT
CCATGTTGGTCGGAGTTCGCACTTCACACAGAATCATAATAGTACAATATCATTTTCTAA
TATACTACATGGAACTGGAGTTAGAAATGTTTGGCTGGGGATTTAGCTCAGTGGTAGAGC
GCTTACCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAAAAAAAAATGT
TTGGGATCTGCCATGTAGGTGTTTGGAACCAAACCAAATCAAGAACAGTACGTGTTCTTA
ACCTCCAAGCTATTTCTCTAATCTACAACTAACTTTCTTTTTAAAGAGTTTCCTTAGCCA
TGGGATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAGCCCAGGTCATCATAG
CAGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTAGGAGCCGTCTGTCCTTC
TGCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAGTGTACACTTGCGCGGTTCTT
GGAAGAGTCTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAAGCTAAGGACCATGTGACC
AGTGTGGCGGCCATTATGTGATTTGGTCTGCATTATTTGTTGGAAAAATGCCACAAGAAG
ATCACACTGGGATTTGAAGTTTCTGGCTAATACTTAGCCGGGTAGCCTTTTGTGGCCTGC
AGATCTTTAAGGCCAGATTGATCTACAAAGAGAAACAGCATTTTTGGAAAAGTGAAATAC
CTTTGTAACCTAACATGCAATTGGTTCAATAAAGACTTTTGAAATTTAAAAAAAAAAAGT
TTCCTTGGCCCCACCCACTCGCTATTGAGGGCTGACACACATAGCTTTATTATGGCATTG
ATATGTTTTCTCCTTTTTTTTTTTAAAGGTTTATTTATTTTATGAGTACACTGTCGCTGT
CTTCAGATACACCAGAAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGT
GGTTGCTGGGAATTGAACTCAAGACCTCTGTAAGAGCAGTCAGTGCTCTTAACCACTGAG
CCATCTCTTCAGCCCTGTTTTCTCCTTCTTGTCTCCGGTGAATTTTTTTTTTTTTTCTCC
ATTGAACTGGCCATTGTGCTCTGGTCCATCAATACAGATGTCTCAGTCTAATTTTTTTTT
TTTCCTTTTTCTTTTTTCTTTTTTTCGGGGCTGGGGACCGAACCCAGGGCCTTGAGCTTC
CTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCGCGATTGTTGTTTTAAAATC
TCAGTTGCTTTATTTTGCTCGTGGAGGCGTGGGAATCCCGATTCCCAGGTGAAAGCCTGC
TAGCTCATGGAGGCAGAGAAAACACCAAGCTGACCTTCCCTCACAGCCAATGCCCCAGAA
ACAGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved