Rattus_norvegicus Locus Mono:391:SNORA74
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:391:SNORA74
Rattus_norvegicus
Mono:391:SNORA74
18
SNORA74
1001..1197
2197
TAAATCCCCAACCCCTACTACTATTTTCTAATAGCACCAGCTTAGCTCTGAAAATACCC
TCCAAATAGGCCACTGACCCTGCCTTACTTAGCCTCTGGTGCACTAGCATTGACATAACT
TTCTAGGTATCTGTCTATTTTGTCCCTCAAATTCTTATTCCTCACCTGACATCGATCCCA
CTTCTAGCAACTTAGAATATTTGCTATTTAAACCATATGTCTAAACTCGGATCAACTCCC
CACCTGCTGTCGTGTACCCAGAATAAGGCTGTCCCCTATCTTTGCTCTTAACTGATTCAT
CTCTCAGGGAAGATGTGTGGGACCCAGGGAAGGACTGAATTGGTTAATTACAAGTTTAAG
AATGTTGTGCACTGTTCAGGTGCTGTAAGTTGCTAAAGCTTGCTTTTTTTTTTTTTAGGA
TGCCTTGAAAGTAGGGTGGTCTTCACCAGGCTAAAAGAATGATTGGGGATTTAGCTCAGC
GGTAGAGCGCCTGCCTAGCAAGAGGAAGGCCCTGGAAGGCCCTGGGTTCGGTCCCCAGCT
CCGGAAAAGAAAAGAAAACAAAACAAAACAAAAAAGAATGATCCACAGCAGGGTGCTGTG
GTTCTCAGGTGAGTGTCTATTCTAGCATTGACTGCTTCCTCTGCCAGGCCTGTGGACTAC
TTTGTATGTATCAGGAAACAATTGGGAAACAAGTTCACTCTTGCCACTTACTGTAGAACT
TTGGGGGGGTTTTTGTTTTGTTTGTTTGAAAGTAGCATAAAATATTTTTGTGTCTGCCAT
TCCAACTAAGGAATGACTTGTAGGAATATTCTATGTCTTAGATAACAATGTATCTTGTTT
CTGTTCACTGCTAAGTGTCTAAGTTTGGTTCCTGCCAAAGGGCAGAGGCTGTTGGACAAA
GCTGAGAGCATAGAGACTTCTGTGATTTCTGTATTCATGTCAGCTACCTGGGGTGGTCCT
GGGATGCATGAGATGGGAAGGGAGAGGGATTTCTGGAACAGTCCAGCAGTTGTCAGCTGC
CCAGGCTGTGTGGTGCCTGTGATTGTGTTACACTGTTGGAAGAGCAAAGGCTGCTTTAGA
AGGGTTGGCTCCAAGCACTGTTTTGGTGTTTGGTGCTGAGTACCTTCAGGCAGTGTATTG
CATCCCTGAGAGTGGAATGACTCCTTGTGGAGTTGGTCCTAGTCTAGGTGCGAACAATTT
TCATGTTAACAGACAAAAGAATTGGGACAGGGACAAAGCTGTGTGTTTATAGGACACTTG
CCTCACATGTACTAAGCCGTGAACCTTACTGACAGTGTGTCACCTTTTCCTCCTTATTCT
AGAGCTGAATGAGATCTGCGTCCATCCAGGACTTCAGGTTTCTGACTACACCGGGTTTTG
AGTAATGTATGTGGTCTCTGATGTAGAGGTACTTCAGTTCAGATGGGGGAAGTTAAGTTT
GCCTTAGAGGGTTACAGAACTGATGAAATTCCAGAGAATGAAGTCCAGCTATGCTTTGGC
AGATGGGACAGCTCACACCCACGACCTCTGAGTTACATACATCTCCAGCTATAATTTGGG
GGGGGGGCTAGATGATATCTGTGTACTACATATGGCTAGCTACTTGCTAATTAAAAAGTA
AGTGGTTTTCAGACATATCTAGTTGGATGGTAGCCATCTTAGAATGTTCCAGAAAGTTTA
GGATACTGCTTTGTAAAAGCAAAGGTTTATAAAGACTTTTTAAATTTATTTTTATTATTT
ATTTATTTATTTTTTAATATTTTTTATTTTTATTTTTTATCCCTATAGTAAATGTTGTTA
GTACTGTCTTTGGCTTTTGCAACTATGTTGCTTCTGTGTGTGAAAAGTAATGTATCGGCA
AATGAACATGGCTATATTCCAATAAAACATAACTGATGAACACTGACATTGGGATTTCAT
TGGCAATTTCAGAGTCAACGTTCCCAAATGTTTGAAAGCTTAAGATCTTCCCAAGGCACA
TTGACAAAGAGATAGCAGGATAAGGATTAGTAACATTTCTGACCTTGAGGATTGAACAGC
ATTAGTCAGGTATCAATATGTATCTTCACAGTTTTCTCTACATATAATTCTCCTGGGTCA
GCCTTCCAAGTACTCGATTCATGAACCACTTGCTAAGCTTTCATTGGTGTTCCTTATTGT
AGAAGGATAAGGTGACTAAATTATCCTGAAGAATCCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved