Rattus_norvegicus Locus Mono:557:SNORA7
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:557:SNORA7
Rattus_norvegicus
Mono:557:SNORA7
10
SNORA7
1001..1140
2140
GGGCAGTCAGTGCTCTTAACCGCTGAGCCATCTTCAGCAGCCCTGAGACATTTTAATAA
TAATAATAATAATAATAATAATAATAATAATAATAATATTATTAGACATTCCCCAACTGT
ACCCTTCACTCAGGACCCATCAAAATAGAGGCTGTGTCTAAACGACTTGGAAAAAGGCTG
GCCACCCTGCAGCCCTCCCTACAGCCGCATATGAAGTCATTGCGTTTCTCCCCCCATTAC
CTCTCCCCAACCCCGCATATAAGCTGTGTTGCATTTCATTTTATAAAACACGATGTCGCC
ACGGCCTGCGCTCCGGGCTTAGCTCGGAGATCGGCTGCTGCCATTCCCACTCCCGAATTA
GCTCTGTCAACAGCCTACTGACGTCTTTCCTGGGAGCTATGATCACTACCCCAGCCCCTC
CCACTTAGCTTCACCAAGGTACGGGCTTGGCTTCCCTTTCTCTGCCCAGCTTTGCTCCGA
GGAAGAAAAACATTGATTGTTTTATTATCTTAGAACTAACCAGATAACACAATTGGTGGG
CAAAGAATCTCTTGCCCTAACCTTATCAGCTAGCCTACATTAGTGGTGGAGGCCGAGGGT
TTTAGCCTCCACAAGACCTTACTGGTTGTTGTGTCCTTCTTGTTCCAAAGTCTGGTGGAA
ACTCTCTTCTTTTGGTGTCTGATACTTTAATGGGACTCGGAAGTCCCACCTTCGCCCAGC
AATTGGCTTCTACTTTTTTTTTTATTGACCAAACCAAGAACCAATTAGGGAGTCAGATTT
GTGTATCAGCTCCTCCCTCTACAAAGCTGTAGCTTTAGGTTGTAGCTTACAGCTCCGGAG
TCTGATTAATCTATCTTGGTGTGTGTTCAATAAACCAGCTCTATTTAACTGAGATAGGGG
TTTGAGTGGTTTGGGCAGCAGTTCCCAGACCCTAACAGGATAAATGAAGTGGTTCTAACA
GTGACAGGGAAATGCTGAAAGCAAAAGGAATGGTTAATTTTGACCTCTTGGGATCGAGTC
TGGAGAACTGCTAGTATTCTGCCAGCTTAGGAAGCAGGAGGGAGAACAAGTCTAGCAGAG
GTACCCATTCCATTCCCAGTTTGCTCAGTAGCTGGTGATTGGAAGACACTCTGCAACATC
ACTCAAGGAAAAAAAAAAAGAAAAAAGAAAAAGGAATGGTTAATTTTGATAGGTGTTTTA
ATAAAGGAGGCTGGTGCAATTGTAAAAGAGGCTTTAATATTAGGGGGAGGGATTTCCTGT
ATTGGAGAAAAGAGGGGAAAAAACCGCACCTCTGACATAATAAGGGAAATAGTTGGGATG
AAACATTTAGTTTAAGTTCCACGTTTTTGTGAGTTTTAGACTGACCTTGAATCCCTGATC
TTCTTGTCTCCACCTCCCAAGTGCTGATTGTGGAGCTACACCGTCATCTCTGGCTCTCGT
TCTTAGATTCTTTCACTGTATCACTAAGCTGTCCTTGAACTAATCCTTCTAGGTGGCTGA
AACTACCACCACACTGGCTCCAAACATTTCTTTTCTTTTAAAGATTTATTATATATAAGT
ACACTATAGCTGTCTTCAGACACACCACATCAGATCTTATTACAGATGGGATTTGAACTC
AGGACCTCTGGAAGGAGTCAGTGCTCTTAACCATTGAACCATCTGTCCTTTTTTTTTTTT
TTTTGTTAAGATTTATTTATGTTTATGAGTGCTCTATTTGCATGAACTCCCGATGGTCAA
AAGAGGGCATTAGTTCCCATTACCGTGTGGTTACTGTGGTTACTGTGGTTACTGTGGTTA
CTGTGGTTACTGTGGTTACTGTGGTTACTGTGGTTACTGGGAATTGAACTCAGGGCCTCT
GGAAGAGCAGCCAGTACTCTTAACCACTGAGTCATCTCTCCAGCAATATTTCTTTTACAA
AGAACTTATGAGCCTATTCTGGTCATACAGCCTATAATCTCCTCAGAGAGAAAGAAGGTT
CAGGAGTTTCAGGTCACCCTTGGCCAAACAGCAAATTCAAGACCCAAAAAGGTGCTATAA
AACACAGCACCTGTCTCAAAATAACAGAAACCAAAACAAGAAGACAAAGCAAAAACTCAT
AAAAAGCTCATATTGAAGGCAATGCTAATCATTGACTAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved