Rattus_norvegicus Locus Poly:26:SNORA57
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:26:SNORA57
Rattus_norvegicus
Poly:26:SNORA57
1
SNORA57, SNORA57
639..786, 2597..2744
3967
TCCTTGTGAGAGGCGGTTTTTGTGAGTCTCCACCCCCGGAGACAAGTCCACTCCTAGAA
CATCCACAGGGTGGGTGTAGGCCCGTGCAGGATTGAGACCTATTTTACTTCCAATAGCCC
CGTGGGAAATCTGTGCCTCATGCAACAGTTTAGATGCCAGGCAGTTTGAGGGTAAGTGTG
GAAGGCCACATGCTACCCCAGGTTAGTTCTGGGATTACACGTGTGCACCCTTATGTTTGG
CTTTTTATCACACCAGTCAACTACAGATTAAGATTCCCTGGTCTTTAGGATCGCACCTTC
CAGGCTCAGGCTTGCATATCCCCGCACCTGGGTCGATATTTGGTGAATTCCACTCAAGAA
TCTTGAGTCTCCCATAAGTTCGACCACAGATCTTTAGTAAATACTCACCCGCACTCCCAA
CATGTGCTTTAAGTCCTAAAGATCGCAAATTCCGAGTCGCAGGAAAAAAAAAGAAACGCA
CACAGGGTTCTTACGGTTCACAGACTTTATTGGTTCAACAATGAACAGCAAAGAAAACGT
TAACTATCACTCCGGGGGCATCATGTAGACCTGAAAAAAAAATAAAAAGCGTTGAGTAAT
TTAGAGGGGACTGCCGGACTTAGCTGCATTTCTGCACGGAGGTGTTCCGGCGTCTGAGGA
TAGAACCTGCGAACGGGAGACCGCAAGCACCGAAGACATAACACCGAGAGGGCCGGAGCC
CTTTCTTCTACCTCCGTACATTACGGGGAGCGGGACCGCACGCCCGTTCCCCGCCAAGAA
AAGGAGGATCTTCAAAGTCAGGCCCAGACCCCAGTAGCTCCCAACTGCCCACGCACAGAA
ACGCAGACCCACCACTTACGTGAAGGCCACCCTTTGAAAGGCCACAGAGCGCGCGGAACA
ACCTTATATAGGCCTAGTGCCCGCCTCCAAACTGTGATTGGTCCGGGGCGTCAGAGGGCG
GGGTCTTGTGCGCGTGGCGGAACCTGCTAGTGGAGCGGAAGTGTGGCTCCGGAGTGAGCC
TCGGAGTGTAGCAATGGCACCTCCGGGAGGAAAGATCAATCGTCCTCGGACGGTGACTGG
ACTGTGGGAGTGGGAACCGTTTTCCCCTTTGTTTCCCTTTGCTTCCCAGCATTTTCTCTC
CGGAAACAGGATCAGTTGGGGCCTTGGTTGTTAGGTGCGGAGGATCCCGGGTGGGCGTGC
ACCACTTTACGTTTATGCGCATCCTTTTTCAAATGCAGGAGCTGAAAAAGAAGTTGTTCA
AGCGCCGCAGGGTACTAAGCAGGGATCGGCGACGGAAGCGCCTGGTGGTCGGGGCTGTGA
TAGACGAAGGGCTGACTACGAAACACCACCTCAAGAAACGTGCGTAAGTACAGTATTAGC
CTCCTCCGGTTGGTCATTCCTACCTACTTCCTACCAAGCTGCAGAACAGCCCAAAGCTCT
CCAATTTTCGCGTTCTCGTTCACGTTTATGCAGGAACTAGTTGACAGTTAGTTTCCAAAC
TACAGCGTCTTCCAATACCATTGCTCACAGGGTTTTGTTGTTGCTGTTGTTTGTTTTGTT
TCGATTTTTCAAGCAGAGTTTCTCTGTAACCTTGGCTGTTCTAGAACTCTCCGAGTTGAC
CAGGCTGGCCTCGAACTCACAGATCCATTTGCCTCTGTCTCCCAAGTGCTGGGATTAAAA
TTGTGCACCACCACCACCCAGCTGCTCACAGGATTTTTTTAGGTTTGGATTCTACTAAGA
AACTAAGGAAGGCTGTCTCCAACCCTAGAAATGGTTAAGTTAGGTTTTTGAAATAAAGGC
ACAAATGTAAATGCATACTATTAAGTTACTGGCATAATACTATTGAGGTACATATTGAAA
TCAAAATAACTGTTAAAAGTCCAAGTGTTGGGGCTAGAGAGATGACTCAGAGGCTAAGAG
CACTGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACA
ACCATCTGTAATGGGATACGATGCCCTCTTCTGGTGTGTTTGAAGACAGCTGCAGTCTCC
TCATATACATTAAATAAATAAACCTTAAAAAAAAAAGTCCAAGTGTTAGAGTTCACTGAG
GATATTAGAGCCCATTAAGTAATTTGAATCCAGAGACTATAAAACTAAATCAGGCATGAT
GCTTCCTGCTTTTTCAAATTCCAGTGCCAGGAGTCTGAGACAGAAAGGTTGGCTGTTTGT
TGGCTAGCCTGGGCTACTTAGCGAGATGTTTTCTCAGCTAGGGTCACTTTTGAGGCTTAG
GTTGGTACAAGCTAACCTGGATGTTTTTGTTGTTTCCCGTGGCCCAGATCCAGTGCACGA
GCCAACATCACGCTCTCTGGGAAGAAGCGCAGGAAACTCTTGCAGCAGATCCGACTTGCC
CAGAAAGAAAAAGCAGCCATGGAAGGTAAATCTGGGGCACAGAGGTTCCACAAAAAGAAG
TCTGGATTTTACCTGAGTTTTATCTTTTTTTTTTTTTTTTTTTTTGGTTCTATTTTTCGG
AGCAGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACTGAGCTAA
ATCCCCAACCCCATGGGGAGTTTTATCTTTAATGCTTCCTTTTTCTTTTTGTTCAGTGGA
AGTTCTCTCCACGTCAACCGGGACTAGTCAGCCAAAGCCCAAACGACAAAAGAAGACACA
AGCTCCCCAGGACGTAGATATGGAAGATCTTGAGGATAAAAGATAAAGTTCCTACCTCTT
CTACCAGAAGATTCTCAACAGCACCTACAAGGATTTGGAGGACTTTGGAAAAAAATATCA
CCATATTTCATTCTCCCAGACACCTCTTCTATAATGGACCCTTGATCTCCCCTGGAGGTA
TATATTGGGATTGAAGAGGACAGAGAAAGACTGGAGAGGGCCCTCTCTAGCAGTTAACTC
CTTTTGTAATAAAGCTCTAGTGCTTTAACTACCATGTGTGATGAAGCACAGTGGGGATGG
GACATAGAGAAAGGCCTTCGAGTGTGAGTGGCGACACTTCAGAAGCAGGACACATTGTGA
GCAACAAGAAACTAGGTAGTGAAGGGCATGGTAGCACATGCCTTTAATTCCAAGATTTGG
GAGGCAGAGGCAGGCTGATCTCTGTTCAAGGCCTCTTTGGTCCTCACATTGAGTTCCAGG
ACAGACAGGACTTTATAAGACGCTATTTTAAAAAGAAACTAGGTAGGTCACTCCCCCGGC
CCCCAACTTTCTAGACAGTGACACTTCCAACTTTGCATTTCTGGAAAGTAGAGATTATTA
GAAGGAGAGCAGATAGGGAGGTAAGGATCTGATAATAGTCTTGACACTATTATAGTAAGG
AACACCTTTTTTTTTGATAGTGGTGTTTAGGAATTCAAACCCAGGGCATCAGGCATTCTA
AGCAACTATTGTGGCATCTACATCCTGAGTGCCTATTCCCTATCAGCACTCATGCTGTAA
GATGTCAGTTCTGAGGACATTGTTTTGATTTTAAAGACAGGGTCTTCCTTATATAGCCCA
AGTTTGGTTTGAACACATGATCTTTCCGCTTCTGCCTCCACAATTCTGGAATTATGGGTA
TGAGACATGTCCAGACCCCTTTCCTAACTTAGAGGGAGGCGGATGATGTAGCTCGGGGAG
TAAGGGTGCTTGACCCAAGCCCGACAACCTGATTCCACCCCTCTTACCCTAATAGTAGAA
GGAGAGCTGACTCCAGTGTTGTCCTCTGGCCTCCACACTTGTACCCTGGCAAGCATGGGC
CCCCATACACACAGTAAATGTCACAGTAAAACAGTAAATTAGTCATGGGCTTGCCACATT
TAATTTTCCATTCCTTATCAACTAAATATCAGTAACAGACAACTTGATGGTTTGAGCCCT
TAGCTCAAAGTATGTGTGTGCACTTTGTGCATTGTGCATGCTTGATGTTCTCAGAGACCA
AAAGAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1071, 1238..1362, 2327..2424, 2636..2967
1033..1071, 1238..1362, 2327..2424, 2636..2745
AC_000069.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved