Rattus_norvegicus Locus Mono:496:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:496:SNORA44
Rattus_norvegicus
Mono:496:SNORA44
14
SNORA44
1001..1130
2130
ATGAGGATGGCGTCACTATTCCGAGGAGAAGGTTTATGTGGTCACAGAGGTTCTTTTTT
ATGAGTGTCGACTTGTTGTTTGTTTTCTGTGTTTCTGCCCAATAGAGAGGAAGAGTTACA
TTGGTGGTTTTATGTGTATTGATTTGTGTGTTCTCCTTTCATGATGACCTTTTGTTTCAG
ATGTTTTTTAATTACATTATTAACGAGTTTGACAGGGTCACGGTCTCGAAGTCTCTGATA
TGTATGGGGTGGGGTATGGGGTGGTGGTGGTGGTGTGGGGTGGTGGTGGTGGTGGTGGTG
GTGTTTTCTTAGCTGGCAAGCATCTAATTGGGGATGCTACTATGGCTTTTTAGCATAATT
GGTTTGTGCTGGAAGTCAGACCATAAATTTAACTTCTGCTACCCTCTGCATCTGGTGGTG
TTTGAGTCAAGGGCAGTCTTCTAACCTAAGGGTAGGATTTGTGGGTGGAGTAACCAGGGA
ACTTTGAGAAAACTTGAGTTAGACACAGCTCTTAATAGAGGAATAACCAGGAGACCTAGG
TCTTGTTGCGGGGGTAAATTGGAAACTAATGCTAGGTACTGGCCTGGTAATTTACTTGAG
TTCAAACTTAGGTCAGGTTCTCTAAAATTGTATTCTGTAAGATTTGGTTTCTCAAGAACT
CATTTTTTCATCCAGAAAAATAAGTTCTTTCTGCTCTGGTACTTGGGCTTTTGTTCCATA
TGCAAATGTAAGGAAGCAGATGTGTGTCTGTGTAAGTATGTATGTTGACTAGATAGATTG
TTGGGCTCAACAAATAAGTATGTATGTGTGAAACTATGTATGGTTACATATATTTACTTG
TGTAAAGTTCTTTCCTTCTGCCAGTGTTGCTCTCCTCTCCTGGTTCAATAGAAGTTTATT
GCTCCAAACTTCTCTAGACTAGCAAGCTAGAGGAGAGGGCAAGAAGAAACCCTTAGAATT
TAATCTTTTAGTTAGCCCCTTGATGTTAGGCTACAGGTGTTAATCACTCAAGCAAGAAAT
TTTTACTGCTCATAGCCATGGGATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGA
CAGCCCAGGTTATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACT
GGAGTTATGAGCTGCCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCA
GTGTGCACTTGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTA
ACCTAAGGACCATGTGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTT
GGAAAAATGCCACAAGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCA
GGTAGCCTTTTGTGGCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAAT
ACCTTTGTAACCTAACATGCAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAA
AAGAAATTTTTAACCTCAGAATAAGCAAGAAAAAATTTTTATGTTATTTTAGAAGCCAGG
AGCATCAGTAGTCTGTATAATTGCAGAGTTTAAAAGCCAGAGATCATCAGTCTTTAAAAC
TACATTTGGAGACCATCCATCTTTAAAGCTATCTCTACATCCAATACTGGTTCCTGCTTC
AACCCATTCCAGGCCTGGCACCACATTATTTCCTTAATTATGCATTATTGATATTAGTGC
TCCATGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGTATGT
GTGTGTGTGTGTGTGCGCCCATGTGTGTGTGTGTGCGCATAGGTTTGTGTGTGATTAAAT
TTGTTAGAGCTTTTTAATTCTATTTTCATTTATTCATTTAAAATTGTATTTATATTCATG
TTCTAAAGTTGCGTTTACCAAAAGAAACAACTTTTTGCTGCAGATTTATATTTATTTTGA
TAATTTATAAAGTATTTTATTTATATTATTCTTACTATTTATGCATACAAAGAACTCATA
GAGGATGCTAGCTTCCTATATTTCTAGATATCACTTTATTTCATTAAAACATTCACAAAT
TATATTTTTCTTACAATAGCTGTTTCAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_005113
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved