Rattus_norvegicus Locus Mono:174:SNORA19
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:174:SNORA19
Rattus_norvegicus
Mono:174:SNORA19
5
SNORA19
1001..1108
2108
TTCTTGGGATCTGGAAGCTGTTCAGTCTCCTTTGGTATCCATAGCTGTGGGTGTTCATG
TGGAAAGAACAGTACACGCCATTTTTTTCTCCTTTTTGGGTATCACTGAATATTTATGAG
TTCTGTGATGTTCGATACAATGCAAAAATCAATTATTACATTTGGAAATATTCATCAAGT
GCTATGAAAGGGGTAAACTTGTTTCAATGTTGAATTATGTTATTATAATTAATTAATATT
AATTAATGTTTATGAGTCTCTATATATTAAAAATGGAATAATTGAACATCAATGATTTCT
AAGGATTTCTTTGCAAAAAAGGTCAAAATACATTCTAGAAAAGTCAGAGGTCATAGTGGA
GAAATATTGATGCATTACAAACTCCAAGTTGTCAAACTTCCTTCCAAATACTTTTATTTG
TTTCATAGATTTGTGCAATAGGTAGATGTTAAAGCAGAGATACATACTACTAAATGTGCT
GAGGAGTGACTCTGCTTGTCAGCTGTAGACGGGACGTTTATATCAACCTCGCTGTTCTTG
AAGGTTCTGGAAACATTATCTATGCTATGAGGTGGGCACATAACATAAAAGAGCTAGAAG
TTGAGGTAAAGTGATACGAAACATCCTCAGAACAAGGCATGGCTGTTATACACATGGAAC
CACAGATGCTATGTATACCTGTACAATATCTGCAAAGAGCAAAGCAGTTATAAATTCCAG
CATGGAGGGAGGTAGCTGAGTTACCCCCTGTAGCTGAGGGAGATGTGCCAGTTGATGAAT
TGTGGAGGAGGAAAGACATTTTATTTTTATTTTTTTTTAGCAGTGTGGCCACTCATAGGA
TCTCCATCCACTCGGGGATGACCTCAAATCTATGAATATAAGGGCAGCGCTAATTGCACT
CAAGAGGTTAAAAAGTAATTAGTAAAGATAATAAAAGTTGATCATGAAATTGTGTGAGAA
ATAGGAGAGTATTAGAAGGAGCTAGAGGGAAAAAGACAAGGATGGAGATGATTAAGATAT
ATATATATCTTATGTGCTATACTAATAGTTGAAGGTTCATTAGCAGAGTAACTGCATATA
GCAATTCTGCCAGTACCCTTCAGACAAAAAAAGATATATATATATATATATATATATATA
TACGCATATATATACATATATATACATATATATATGATATTTTCAAATAACAAGTCATAA
AAATTAAAATTAATTTAAAAAACCTATGTCCAAACTTTTGTTCATATATCAATATGAGGA
ACATTTGATGTGGGCCTCCAGTCTTCTCTTCATATATCACTACACATGACTTAAAATAGA
GAAGAGAATGATATTAAGTCCAATGTACATTTGAAATATTAAGACAACTTATTATAATTT
TAAATAGATATTTTAAAGTTATCTACTTACATGAGTCTGTGTATACACAAGTGAATGATT
GAATGCACACGTACATGCATGCATGCCACAGAGCCTCACATAGTAGAAAGCAAGAGAGAG
CTGACTTCTCTAAATTTTCATCTGAACTTACAGAAGTCAGTTCTCTCCTTCTACAATGTG
AGACTCATGTATGAAACACAGGTCATCAAACTTAAGTGAAACATGACTTTCTTTTCTGAG
TCATTTCTCTGACCCTATATTTATATTATTAATACTGAAAATAGAAGATAATCATTTAAT
TTTATTTCCAGAAATCACTAATGAATATGTTGGCAGATTTATAAGTAGAAATTCTTATCT
TGAACATCGTGAACAAGTGCAAAAGACGATTAAGAATATCACCATCCCTACCTTAAAGCT
GTATTACAAAGCAATAGTGATAAAACCTGTATGGTATTGATAACAGGGACAAGCAGGTAG
ATAAATGGAAAATAATTGAAGACCCAGAAATGTACCCATATACCTGTGGTCACTTGATCT
TTGACAAAGGAGCTAAAACCATCCAGTGGCAAAAAAAAAAGATAGCATTTTCAACAAATG
GTGCTAGTTCAACTGGAGGTCAGCATGTAGAAGAATGCAAATCGATCCATTCTTATTGCC
CTATACAATTCTTAAGTCCAAGTGGATCAAAAATCTCCACATCAAACCAGATACACTCAA
ACTAATAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved